LIBRARY

KOREA  ASSOCIATION FOR CREATION RESEARCH

창조설계

Jeffrey P. Tomkins
2016-10-12

내부 텔로미어로 보이는 염기서열은 풍부하고 기능적이다. 

(Internal Telomere-like Sequences Are Abundant and Functional)


     오늘날 과학계를 점령하고 있는 진화론에 의하면, 사람과 침팬지는 약 600만 년 전에 살았던 한 공통조상(a common ancestor)으로부터 각각 후손되었다고 주장되고 있다. 이 믿음에 대한 가장 많이 인용되고 있는 증거 중 하나는, 사람의 2번 염색체(chromosome 2)에 있는 (그들의 주장으로) 융합 부위이다. 진화론자들은 두 개의 텔로미어가 융합된 곳에서 퇴화된 잔해를 볼 수 있다고 주장한다. 그들은 이것을 사람의 진화 역사에서 남겨진 자취(leftovers)라고 말한다. 


텔로미어(telomeres)는 식물과 동물의 염색체 말단에서 발견되는 특별한 DNA 염기서열이다. 덜 복잡한 원형 염색체를 가지고 있는 단세포 박테리아의 염색체와 대조해볼 때, 텔로미어들은 커다란 선형의 염색체들을 가진 세포들이 더 복잡한 형태로 존재할 수 있도록 독특하게 설계되어 있다.  


과학자들은 사람 유전체(genome)의 염기서열 분석 시에, 텔로미어 서열 부분들이 염색체의 말단 부위에 독점적으로 있는 것이 아니라, 염색체의 내부 부위에도 존재하는 것을 발견하곤 매우 흥미로워 했다.[1] 처음에, 그러한 ‘간질성 텔로미어 염기서열(interstitial telomere sequences, ITSs)’은 어떤 유용한 목적을 가지고 있지 않은, 유전적 실수로 생각했었다. 사람의 2번 염색체에 있는 유명한 헤드-투-헤드 간질성 텔로미어 염기서열(head-to-head ITS)은 처음에는 두 조상되는 유인원 염색체들의 실수에 의한 융합(an accidental fusion)에 기인한 것으로 추측했었다. 그러나 이러한 추정은 틀렸음이 밝혀졌다. 오늘날 이 특별한 ITS는 촉진유전자(promoter)라고 불리는 일종의 제2의 유전자 스위치로서 기능을 하는, 한 고발현 유전자의 중간 부위에 있는 것으로 알려져 있다.[2, 3] 텔로미어에는 유전자가 완전히 없으므로, 어떤 텔로미어들의 융합이 기능적 유전자를 생성하는 적절한 DNA 염기서열을 제공한다는 것은 불가능하다.


또한 몇몇 과학자들은 ITSs는 유전체에 사실상 위험을 야기시킬 수 있다고 생각했었다. 그리고 연구자들은 ITSs가 질병, 암, 염색체 절단과 관련되어 있는지를 조사해왔다.[1] 그러나 더 많은 연구들에 의하면, 이러한 비정상은 주로 ITSs와 물리적으로 가까이에 있는 다른 염기서열과 관련이 있었으며, 그들의 존재와는 아무런 상관이 없었음을 보여주었다.[1]


놀랍게도 ITSs는 우연히 생겨났다는 진화론적 개념과는 다르게, 설계되었음을 가리키는 강력한 증거들을 보여주고 있다. 염색체의 내부 영역에 존재하는 ITSs는 DNA의 구조적(3차원적) 특성을 변경시킴으로서 유전자 발현에 영향을 주고 있었다.[4] 과학자들은 전형적인 진화론적 사고방식으로, ITSs를 우연한 사고로 생겨난 것으로 전제하고, 그것의 목적과 기능을 찾아보려는 연구 대신에, 유전체에 어떠한 나쁜 영향을 끼치는 지를 연구해왔다. 이러한 역방향적인 접근에도 불구하고, 그들은 결국 ITSs가 유전체내에서 고유한 기능을 가지고 있다고 결론 내렸다.


한편 사람의 2번 염색체의 융합 부위로 주장되는 곳에서, 나는 ITSs가 유전자 발현과 관련된 명백한 하나의 기능을 가지고 있는 요소임을 보여주었다.[2, 3] 따라서, 유전체를 가로지르며 있는 다른 ITSs 부위도 중요한 유전자 조절 기능을 가지고 있을 가능성이 높다. 이러한 생각에 기초하여, 나는 엔코드(ENCODE, ENCyclopedia Of Dna Elements, DNA 백과사전) 프로젝트가 공개한 광범위한 데이터 세트들을 사용하여, 사람 유전체를 가로지르며 존재하는 ITS 부위들을 확인해보았다. 엔코드 프로젝트는 유전체를 가로지르며 있는, 수많은 기능적 DNA 염기서열 데이터들을 제공하고 있다. 그리고 이것은 한 특별한 DNA 염기서열의 기능을 결정하는 데에 이상적이다. 본인의 예비 데이터들은 사람 유전체에 있는 많은 ITS 부위들은 전사인자(transcription factors)라 불리는 특수한 유전자 스위치 단백질의 결합을 포함하여, 유전자 발현(gene expression)과 직접적으로 관련되어 있음을 보여주고 있다.

사람의 2번 염색체에서 융합 부위로 주장되는 곳에 있는 ITSs가 유전자 발현에 관여한다는 발견은, 그 위치가 독특한 부위가 아니라는 것을 보여주고 있다. ITSs(간질성 텔로미어 염기서열)은 사람과 침팬지의 공통조상을 가리키는 것이 아니라, 전지전능하신 창조주에 의한 염색체 내에 공통적 기능적으로 설계된 특성임을 나타내고 있는 것이다.



References

1.Lin, K. W. and J. Wan. 2008. Endings in the middle: current knowledge of interstitial telomeric sequences. Mutation Research. 658 (1-2): 95-110.
2.Tomkins, J. P. 2013. Alleged Human Chromosome 2 'Fusion Site” Encodes an Active DNA Binding Domain Inside a Complex and Highly Expressed Gene—Negating Fusion. Answers Research Journal. 6: 367-375.
3.Tomkins, J. P. 2015. More DNA Evidence Against Human Chromosome Fusion. Acts & Facts. 44 (8): 10-12.
4.Revaud, D. et al. 2009. Sequence-driven telomeric chromatin structure. Cell Cycle. 8 (7): 1099-1100.

* Dr. Tomkins is Director of Life Sciences at the Institute for Creation Research and earned his Ph.D. in genetics from Clemson University.

 

*ICR, That’s a Fact. (2분짜리 동영상)
http://www.icr.org/thatsafact

Cell Origins


https://vimeo.com/146125187

Chimp DNA


https://vimeo.com/102354414

The Secret Code


https://vimeo.com/87053094

Useless Body Parts


https://vimeo.com/33460641


번역 - 미디어위원회

링크 - http://www.icr.org/article/9585 ,

출처 - ICR, Acts & Facts. 45(10), 2016

옛주소 : http://www.kacr.or.kr/library/itemview.asp?no=6467

참고 : 6389|6363|6321|6126|5762|6319|6003|5900|5831|6148|6207|6138|6134|5950|6105|5734|6312|5863|5799|5787|5728|5667|5653|5580|5558|5474|5411|5441|5226|5702|5251|4810|4366|6118|6394|4046|6380|6266|4672|5954|5949|5947

Jeffrey P. Tomkins
2016-06-29

3차원적 구조의 DNA 암호가 발견되다! 

: 다중 DNA 암호 체계는 진화론을 기각시킨다. 

(Three-Dimensional DNA Code Defies Evolution)


      과학자들은 유전체(게놈)에 결합하여 유전자 스위치를 켜고 끄는 전사인자(transcription factors, TFs)라 불리는 단백질들에 대해서 오랫동안 당황해왔었다. 그러나 DNA의 3차원적 모양을 포함한 새로운 한 연구는 상호작용하는 엄청나게 복잡한 생화학적 암호 시스템을 밝혀내고 있었다.[1]


유전자들은 전사인자라 불리는 복잡한 네트워크에 의해서 유전체를 가로지르며 켜지고 꺼진다는 것은 알려져 있었다. 이들 전사인자들은 유전자들 주변과 내부의 전략적 위치에서 DNA와 결합한다. 그러나 전사인자가 결합한 장소에서 무엇이 일어나고 있는지를 발견하는 것은 극도로 어렵다는 것이 입증되어 왔었다. 


전통적으로, 연구자들은 거기에 어떤 일관된 패턴이 있을 것으로 생각하고, 어느 DNA 염기배열이 어느 전사인자와 결합하는지를 이해하려고 노력해왔고, 거기에 초점을 맞춰왔었다. 그러나 이러한 시도는 단지 약간의 성공만을 거두었을 뿐이다. 왜냐하면, 어떤 주어진 전사인자는 다양한 다른 DNA 염기배열들과 결합할 수 있었기 때문이었다. 이것은 그들의 DNA 결합이 고도로 조직 특이성을 보이며 엄격히 조절되고 있다는 사실에도 불구하고 사실이었다. 그 논문의 저자는 말했다. ”유전체 내 표적 장소에 전사인자들이 고도로 특수하게 결합하는 메커니즘은 거의 이해되지 않고 있다.”


그러나 새로운 연구는 DNA가 전사인자들에 의해서 읽혀지는 방법에 영향을 미치는 두 가지 주요한 사실을 밝혀내었다.

1. DNA의 실제 염기서열
2. 그것이 읽혀질 때 DNA의 구조적 형태

이들의 결합 장소에 대한 염기순서는 특정 전사인자와 결합하는 DNA의 조각에 대한 염기서열 분석(sequencing)을 통해서 비교적 쉽게 결정할 수 있다. 그러나 결합에 영향을 주는 두 번째 요인(DNA의 3차원(구조적) 형태)을 발견한다는 것은 쉬운 일이 아니다. 


DNA는 뉴클레오티드라 불리는 4개의 다른 분자들(A, T, G, C로 표현되는)로 이루어진 이중 가닥의 나선이다. 뉴클레오티드 위치 사이의 상호 의존성은 염기 쌍 사이의 물리적 상호작용에 의해서 유래한다. 이러한 상호작용은 DNA의 3차원 구조를 발생시키고, 이것은 차례로 전사인자가 특정 결합 장소를 인식하는데 도움을 주고 있었다.[2] 그 연구에서 연구자들은 관찰했다. ”현재까지 DNA 인식의 형태(모양) 기반 모델의 체계적이고 포괄적인 조사는 부족했다.”[1]


과학자들은 새로운 생화학적 조사에서 얻어진 정보뿐만 아니라, DNA에서 전사인자들의 단백질 결합 생화학에 관해 이전에 연구됐던 광범위한 데이터들을 사용했다. 또한 그들은 모든 데이터들을 습득 평가하는 통계기계라 불리는 기법을 사용하여, 복잡한 알고리즘 개발 시스템을 사용했다. 이러한 세 가지 출처의 정보들은 DNA 염기서열 뿐만 아니라, DNA 형태(DNA shape)를 고려하는 새로운 결합 모델의 개발을 가능하게 해주었다. DNA 염기서열 자체만을 사용하는 표준 모델에 반하여, 그들이 그들의 모델을 시험했을 때, 새로운 시스템은 표준모델을 크게 능가하는 우수한 성능을 보여주었다.


과거 뉴스 보도들은 유전체의 다중 암호(이중 암호)가 DNA 염기서열의 동일한 선형 배열에 포함되어 있었고, 다른 기능들을 수행함을 보여줬었다.[3, 4] 이제 DNA 염기순서에만 기초하는 것이 아닌, 또 다른 종류의 암호가 추가될 수 있게 되었다. 그것은 DNA의 3차원적(3D) 모양에 기초한 암호인 것이다. 선형의 암호와 3D 암호가 함께 작동되어, 유전자 스위치를 켜고 끄는 유전자 발현 분자기계가 정확하게 어느 위치에서 결합해야 되는 지를 지정해주고 있었던 것이다. 


이제 이 새로운 연구 보고서의 또 다른 주목해야만 하는 점은, 이러한 DNA의 3차원적(3D) 모양에 기초한 암호는 진화론을 완전히 기각시키고 있다는 것이다. 진화론은 이러한 놀라운 복잡성을 도저히 설명할 수 없다. 이러한 극도로 정교하고 복잡한 다중 암호 시스템들이 우연히 어쩌다 생겨났는가? 그것은 터무니없고 완전히 불합리한 주장인 것이다. 이러한 놀라운 발견으로부터의 (복잡한 생화학 및 컴퓨터 해석 알고리즘을 사용한) 명백한 합리적인 결론은 초월적 지혜의 창조주께서 이러한 암호 시스템을 설계하시고 만드셨다는 것이다.   



References

1. Zhou, T., et al. 2015. Quantitative modeling of transcription factor binding specificities using DNA shape. Proceedings of the National Academy of Sciences. 112 (15): 4654–4659.
2. Rohs, R., et al. 2009. The role of DNA shape in protein-DNA recognition. Nature. 461 (7268): 1248–1253.
3. Tomkins, J. 2014. Duons: Parallel Gene Code Defies Evolution. Creation Science Update. Posted on icr.org January 6, 2014, accessed April 14, 2015.
4. Tomkins, J. 2014. Dual-Gene Codes Defy Evolution...Again. Creation Science Update. Posted on icr.org September 12, 2014, accessed April 14, 2015.

*Dr. Tomkins is Research Associate at the Institute for Creation Research and received his Ph.D. in Genetics from Clemson University.



번역 - 미디어위원회

링크 - http://www.icr.org/article/8691

출처 - ICR News, 2015. 4. 27.

구분 - 4

옛 주소 - http://www.kacr.or.kr/library/itemview.asp?no=6148

참고 : 5831|6003|5836|5900|5580|5474|6134|5883|5734|5784|5950|5558|5454|5949|5954|6000|6009|6105|6138|6207|6274|6314|6126|6361|6389|5655|5762|5994|6321|6363|6148|6467|6468|6474|6487|6495|6599

Randy J. Guliuzza
2016-06-10

되돌이 후두신경은 형편없는 나쁜 설계가 아니다. 

(Major Evolutionary Blunders 

: The 'Poor Design' of Our Recurrent Laryngeal Nerve)


     ”당신 또 시작이군요(There you go again)” 1980년 미국 대통령 선거 토론에서 로널드 레이건(Ronald Reagan)이 현직 대통령이었던 지미 카터에게 했던 유명한 말이다. 이 간결한 구절은 모욕은 아니지만, 확실히 듣기 좋은 말은 아니다. 이 말은 상대방의 주장이 진실이 아닌 잘못된 주장이며, 오래된 진부한 주장임을 의미하는 말이다.


최근 월스트리트 저널에 게재된 데이비드 바라쉬(David Barash)의 글에 대해서도 ”당신 또 시작이군요” 라는 말은 적절해 보인다. 그는 '불완전한 복제품'이라는 제목의 글에서, 사람의 몸(human bodies)은 잘못 설계된 모든 것들 중에서 으뜸이라는 오래된 진화론적 주장을 앵무새처럼 되풀이하고 있었다.[1] 진화 심리학자인 바라쉬는 제레미 테일러(Jeremy Taylor)의 책 ‘진화된 몸(Body by Darwin)’을 리뷰하며 흥분하고 있었다. 그 책은 사람의 몸이 진화적 역사를 어떻게 반영하고 있는지에 대한 몇 가지의 주장되는 예들을 나열하고 있었다. 많은 진화론자들은 생물체에서 '형편없는 설계(poor design, 나쁜 설계)'라는 것들이 창조론을 반대하며 진화론을 지지하는 과학적 증거라고 믿고 있다. 그러나 그러한 사고는 많은 문제점들을 가지고 있다.


지적인 설계자가 형편없는 설계를 하지 않았을 것이라는 의견은 본질상 과학적인 주장이 아니라, 신학적인 주장이다. 그럼에도 불구하고, 많은 진화론자들은 형편없는 설계의 증거를 찾아내는 일이 과학적 연구라고 믿고 있다. 그러나 형편없는 설계로 말해지고 있는 구조들도 진화론적 추정과 외삽(즉, 상상)들과 비교해보면 극히 일부분이다.[3] 그리고 객관적인 실험으로 '형편없는 설계'가 입증된 적은 없다. 그렇다면, 어떻게 진화론자들은 한 구조를 보고 형편없는 설계라고 주장하고 있는 것일까?


‘형편없는 설계’라는 주장은 어떤 생물체를 보고 ‘원시적’이나, ‘전이형태’라고 말하거나, 또는 ‘자연선택의 사례’, ‘수렴진화의 사례’라고 주장하는 것과 유사한 것이다. ”당신 또 시작이군요”에 해당하는 이러한 주장은 명백한 관측에 의해서 이루어진 실체가 아니라, 모두 상상에 의한 추정적 해석이다. 그러나 자연주의적 세계관을 가진 세속적 과학자들은 자연에서 이러한 형편없는 설계를 찾기 위해 애쓰고 있다.

 

진화론자들은 자연이 생물들을 무작위적으로 서툴게 고쳤을 것이라고 믿고 있다.

형편없는 설계라는 개념은 생각(뇌)이 없는 자연(mindless nature)이 생물들을 창조해냈다는 개념과 분리될 수 없다. 자연은 어떻게 생물들의 형태를 결정하는가? 최근에 보스턴 대학의 진화 생물학자 데이비드 레빈(David Levin)은 자연이 어떻게 생물들을 천천히 조각들을 함께 붙여나가는 지를 설명하고 있었다. 첫째, 생물의 DNA에서 무작위적인 돌연변이는 자연의 힘에 의해서 발생한다. 후에 자연은 부적합한 것에 대해서 죽음이라는 비용을 지불하고, 오직 최적자로 생존한 개체를 선택한다. 그리고 이러한 방법으로 ‘자연선택(natural selection)‘은 환경에 따라 유전체를 조각한다.'[4]


조각한다고(sculpting)? 독자들은 미켈란젤로의 작품처럼 예술가가 심혈을 기울여 조각하는 행동으로 잘못 생각할 수도 있을 것이다. 그와는 대조적으로 레빈의 조각은 장구한 세월에 걸친 투쟁과 죽음을 통해 덧붙여진 수억 수천만 개의 유전적 개조를 의미한다. 레빈의 그러한 상상의 조각 과정에 대한 유일한 증거는 그의 생각으로 형편없어 보이는 여러 설계들이 존재한다는 것이다. 그러나 조각 과정이나 형편없는 설계로 분류하는 일은 객관적인 관측에 기초한 것이 아니다.


레빈과 같은 진화론자들은 이 보편적인 과정이 본질적으로 계획되지 않은, 무작위적인 것으로, 뒤죽박죽일 것으로 믿고 있다. 두 진화 생물학자들은 ”다중 협력 전사인자가 발달 조절자의 존재에 유리하게 작용한 병합된 결합부위를 포함하여, 함께 서툴게 수선된 조절(유전자) 요소들이 흔하게 나타날 것이라고 믿고 있다.”[5] 다른 진화 연구자들은 ”유악류 및 무악류 척추동물의 헤모글로빈은 독립적으로 발명됐다는 발견은, 서툴지만 다른 재료들을 사용하여 유사한 설계를 만들어낼 수 있는 자연선택의 능력이 강력함을 보여주는 것”이라고 주장한다.[6] 자연이 어떤 것을 조사하고 채택할 수 없음에도 불구하고, 진화론자들은 자연선택이 자연에 놀라운 창의력과 전략을 제공할 수 있다고 쉽게 생각해 버린다.

사람의 신체 구조에서 '형편없는 설계'의 목록에는 DNA 자체 뿐만 아니라, 일련의 혈액 응고 반응과 같은 분자적 특성들과, 눈(망막), 목, 산도(birth canals) 등이 포함된다. 또한 진화론자들은 우리의 목에 있는 한 긴 신경인 되돌이 후두신경(recurrent laryngeal nerve, RLN)이 형편없는 설계를 보여줄 뿐만 아니라, 오래 전에 물고기로부터 후손됐음을 가리키는 증거라고 주장하고 있다. 과학적 지식이 축적됨에 따라, 이러한 주장들은 진화론자들의 무지로 인한 실수였음이 밝혀지고 있다. 최근 조사에 의하면, 되돌이 후두신경이 형편없는 설계의 사례라는 진화론자들의 주장이 이전의 실수처럼 또 하나의 실수였음이 밝혀진 것이다.


되돌이 후두신경은 부적응된 것인가?

후두에 있는 성대(vocal cords)는 좌우의 후두신경(laryngeal nerves)에 의해서 지배받는다. 이들 신경은 뇌신경의 하나인 미주신경(vagus nerve)에서 분기된다. 왼쪽에서 미주신경은 두개골에서 시작하여, 목 아래로 심장을 향해 내려간다. 되돌이 후두신경은 대동맥(aorta) 바로 아래에서 미주신경과 분기되어 나뉘어진다. 대동맥 아래를 고리처럼 돌아, 되돌이 후두신경은 위쪽으로(되돌아) 올라가며 여러 장기들을 제어하며, 후두에 도달한다. 진화론자들은 왼쪽 되돌이 후두신경이 후두 가까이에서 분기되지 않은 것은 형편없는 설계라고 주장한다. (왼쪽 RLN이 오른쪽 RLN 보다 더 길지만, 각 신경 신호들을 조정되어, 성대는 동시에 자극되고, 정상적 발성이 이루어진다는 것을 주목하라.)


시카고 대학의 진화론 명예 교수인 제리 코인(Jerry Coyne) 박사는 형편없는 설계에 대한 그의 목록에 되돌이 후두신경을 열거하고 있었다. ”진화가 사실인 이유”라는 책에서, 그는 ”자연계에서 최악의 형편없는 설계 중 하나가 포유류에서 이 되돌이 후두신경이다” 라고 주장했다. ”이 이상한 신경은 필요한 것 이상으로 훨씬 더 길다(약 60cm).” 그는 후에 덧붙였다, ”이 되돌이 후두신경의 우회 경로는 형편없는 설계일 뿐만 아니라, 심지어 부적응의 사례일 수 있다.”[7]


그는 그 신경 경로에 대한 유일한 합리적인 설명은 그것이 원래 물고기의 아가미에서 시작했기 때문이라고 주장한다. 나중에 물고기에서 양서류가 진화했고, 파충류와 포유류는 양서류로부터 진화했다. 그 다음에, 그는 말했다. ”사람의 진화 동안에 우리의 심장은 대동맥의 역진화를 유지하기 위해 가슴 쪽으로 이동했다. 따라서 후두신경은 길게 늘어나게 되었고, 우리의 후두(물고기는 가지고 있지 않은)로 위쪽으로 되돌아갔다.”[7]


고생물학자인 도널드 프로테오(Donald Prothero)도 동일한 주장을 하고 있었다. ”그러한 설계는 낭비적이다... 뿐만 아니라, 이 신경의 기괴한 경로는 진화적 측면에서 완벽하게 의미가 있는 것이다. 물고기와 초기 포유류 배아에서, 되돌이 후두신경의 전구체는 목의 깊은 부위에 있는 여섯 번째 아가미활(gill arch)에 부착되어 있었다.”[8]


되돌이 후두신경의 구조는 진화론을 찬성하는, 형편없는 설계의 부정할 수 없는 증거로 간주되며 대대적으로 선전되고 있었다.


되돌이 후두신경 : 진화론자들의 주장은 완전히 잘못된 것이다!

십 년 이상 전에 출간된 프로테오나 코인의 책에 쓰여진 문헌들은 되돌이 후두신경이 대동맥 궁 아래를 지나 고리처럼 되어있는 것에 대한 아주 좋은 이유를 설명해주고 있었다. 되돌이 후두신경은 태아의 출생 전 발달 동안에 몇몇 핵심적인 역할을 수행하고 있다. 그들 중 하나는 매우 중요하며, 흥미롭다.


배경 설명을 하자면, 태아가 어머니의 자궁에서 발달하는 동안, 양수 속에서 살아가고 있으므로, 태아의 폐는 산소 교환을 위해 작동되지 않는다. 따라서 대부분의 피는 폐로 가지 않고 어떤 임시적인 지름길(temporary shunts)을 통해서 지나간다. 하나의 지름길이 폐동맥과 대동맥을 연결하고 있는, 근육 벽으로 이루어진 한 작은 동맥이다. 그것의 라틴어 이름은 동맥관(ductus arteriosis)이다. 아기가 출생을 하여 첫 번째 숨을 쉬면, 그 동맥은 특정 신호를 감지하고, 그 동맥관을 폐쇄시키기 위해서 근육 벽을 수축시킨다. 이제 혈액은 폐로 강제로 송출되는 것이다. 왜 동맥관은 다른 동맥들에 비해 훨씬 더 적은 탄성 섬유들의 근육 벽으로 되어 있는 것일까?


존스 홉킨스 의과대학의 연구자들은 태아의 발달 동안 ”왼쪽 미주신경과 되돌이 후두신경의 분기(나눠짐)는 좌측 여섯째 대동맥 궁의 말단(또는 동맥관 구성요소)을 지지하는 하나의 고리(a sling)를 형성한다”는 것을 발견했다. 놀랍게도, 연구자들은 자신들의 연구에서 다음과 같은 것을 발견했다 :

지지하는 신경 아래에 있는 동맥관의 중막(media, 혈관 벽의 구성물)은 더 얇고, 인접한 대동맥 궁의 탄력적인 층판 중막보다 적은 탄성 섬유를 갖고 있다. 이 연구는 미주신경과 되돌이 후두신경이 태아의 발달 동안에 동맥관을 기계적으로 지지하고(mechanical support) 있는 위치에서 있으며, 지지되고 있는 동맥관의 중막의 형태(또는 구성물)가 인접한 지지되지 않는 대동맥 궁의 중막의 형태와 차이가 있음을 보여주고 있다. 이 부위의 기계적 지지는 정상적 동맥관이 하나의 근육성 동맥으로 차별화되는 이유가 될 수 있음을 가리킨다. 따라서 출생 후에 그 내강을 폐쇄시킬 수 있는 것이다. 그러한 지지가 없었다면, 동맥관 중막은 지지되지 않는 정상적인 대동맥이나 폐동맥 가지들처럼 풍부한 탄성 섬유들을 발달시켰을 것이다. 그래서 출생 후에도 폐쇄되지 않아, 동맥관 개존증(patent [or open] ductus arteriosus)이라는 비정상적인 질환을 갖게 될 것이다.[9]  

태아 발달에 관한 이러한 최근 연구에 의하면, 되돌이 후두신경이 정확한 기계적 지지를 제공함으로서, 태아의 발달 동안 동맥관이 정확하게 형성되었다가 출생 후 폐쇄되도록 하는, 매우 현명한 메커니즘인 것으로 보여진다. 이 되돌이 후두신경은 좌측 성대를 조절하는 것 외에, 다중의 목적이 있었던 것이다. 그 신경의 길이, 위치, 기능 모두는 천재적인 설계로서, 형편없는 설계가 아니었던 것이다. 우리 몸에서 되돌이 후두신경의 위치가 오래 전의 물고기 조상으로부터 기인됐다는 주장은 또 하나의 커다란 진화론적 실수이며 오류인 것이다.


'형편없는 설계'라는 주장은 무지로부터 생겨난 주장이다.

진화론자들이 '형편없는 설계'라는 주장을 할 때, 대체적으로 그러한 구조에 대한 지식이 매우 부족하다는 것을 보여준다. 비판가들은 사실 그 구조에 대한 최근의 연구 결과들에 대해서 잘 알지 못하고 있다. 그들은 자신들이 비판하는 구조에 대한 정확한 기능에 대해 무지하며, 그들의 주장에는 여러 다른 문제점들도 들어 있다.

계적 관점에서, 되돌이 후두신경에 대한 진화론자들의 실수는 여러 상충적 요인들에 대해 균형을 맞출 필요에 대해 그들이 알지 못하고 있음을 명확하게 보여준다. 설계에서 이러한 원리는 최적화(optimization)로 알려져 있다. 진화론자들이 놓치고 있는 것이 있는데, 설계는 단지 어떤 하나의 특성만을 최대로 수행하기 위해서 이루어지는 것이 아니다. 진화론자들은 어떤 실체가 전체적으로 설계되었는지 아닌지를 살펴보려고 하지 않는다. 그들은 아직 발견되지 않은 다른 기능들뿐만 아니라, 여러 특성들을 두루 살리기 위한 설계적 교환(tradeoffs)을 무시하고 형편없는 설계라고 비판한다. 여러 기능을 갖게 하는 설계적 교환 작업은 어려운 일이다. 그것은 하나의 설계 뒤에 또 다른 설계가 들어있는, 지성(intelligence)에 대한 강력한 증거인 것이다.   


그리고 형편없는 설계가 사실이라 하더라도, 그것이 설계 자체를 부정할 수는 없는 것이다. 사람에 의해서 설계된 제품들을 보면, 간단한 것에서부터 극도로 복잡한 제품까지 다양하다. 제품의 품질이 지적설계의 여부를 결정하는 것이 아니다. 천재적인 설계도 최고의 품질을 요구하지 않을 수 있다. 어떻게 설계됐는지에 대한 논란은, 설계되었는지 안 되었는지에 대한 논란과는 아무런 상관이 없는 것이다.


형편없는 설계 : 진실인가, 상상인가?

애비 하퍼(Abby Hafer)는 그의 책 ”지적이지 않은 설계자: 사람의 몸을 지적설계가 아닌 진화로 설명하는 이유”에서 이렇게 주장하고 있었다.[10] ”케네스 밀러는 복잡한 생화학적 경로는 한때 다른 기능을 가지고 있었지만 새로운 용도로 공동 선택됐던, 원시적 전구체 단백질로부터 함께 서투르게 수선되었음을 보여주고 있다.”[11] 당신 또 시작이군요.


진화론자들의 글을 읽을 때, 독자들은 사실을 잘못 이해하고, 왜곡하고 있으며, 관측이 아닌 추정으로 일관된 유해한 글들을 읽고 있다는 사실을 기억해야 한다. 그러한 글들은 습관적으로 자연이 어떤 일을 계획하고, 발명하고, 모으고, 서툴게 수선할 수 있는 것처럼, 의인화하고 있다. 그리고 자연선택이 어떤 환경에서 유전체를 바꾸고 조각할 수 있는 것처럼 말한다.[12] 다윈의 진화적 과정은 진화론자들의 마음속에만 있는 환상과 같은 것이다. 진화론을 현실 세계로 도입할 때, 서로 충돌하며, 많은 오류들과 문제점들을 초래하는 것은 이상한 일이 아니다.


세계관이 중요하다. 창조론자들은 사람이 만든 복잡한 물건과 지구상에서 살아가는 생물들은 유사한 특성들을 가지고 있기 때문에, 그것들 모두는 설계되었고, 목적을 가지고 만들어졌다고 추론한다. 환경적 인자들은 지능이 없고, 계획할 수 없고, 어떤 설계를 할 수 없기 때문에, 그것만으로 어떤 간단한 장기라도 생겨나게 할 수 없다. 생물체의 어떤 장기가 형편없는 설계라는 주장은 사실상 설계를 인정하고 말하는 주장이다. 실제로, 생물들은 숨이 멎을 만큼의 경이롭고 완벽한 장기들과 구조들을 가지고 있다. 생명체의 복잡성과 완벽에 가까운 기능들은  대부분의 사람들에게 분명히 보여 알려졌으며(롬 1:20), 정말로 경이로운 수준의 것들이다.[14]

 


References
1. Barash, D. Imperfect Reproductions. The Wall Street Journal. Posted on wsj.com January 29, 2016, accessed February 4, 2016.
2. Taylor, J. 2015. Body by Darwin: How Evolution Shapes Our Health and Transforms Medicine. Chicago, IL: The University of Chicago Press.
3. Guliuzza, R. J. 2015. Major Evolutionary Blunders: The Imaginary Piltdown Man. Acts & Facts. 44 (12): 12-14.
4. Spetner, L. M. Information and mutation—Responding to David Levin. Evolution News and Views. Posted on evolutionnews.org February 2, 2016, accessed February 5, 2016.
5. Hersh, B. M. and S. B. Carroll. 2005. Direct regulation of knot gene expression by Ultrabithorax and the evolution of cis-regulatory elements in Drosophila. Development. 132 (7): 1567-1577.
6. Simons, T. Biologists find that red-blooded vertebrates evolved twice, independently. University of Nebraska-Lincoln news release. Posted on newsroom.unl.edu July 26, 2010 accessed February 9, 2016.
7. Coyne, J. 2009. Why Evolution Is True. New York: Viking, 82-84.
8. Prothero, D. R. 2007. Evolution: What the Fossils Say and Why It Matters. New York: Columbia University Press, 37-38.
9. Leonard, M. E., G. M. Hutchins and G. W. Moore. 1983. Role of the vagus nerve and its recurrent laryngeal branch in the development of the human ductus arteriosus. American Journal of Anatomy. 167 (3): 313–327.
10. Hafer, A. 2015. The Not-So-Intelligent Designer: Why Evolution Explains the Human Body and Intelligent Design Does Not. Eugene, OR: Cascade Books.
11. Coyne, J. A. Seeing and Believing: The never-ending attempt to reconcile science and religion, and why it is doomed to fail. The New Republic. Posted on newrepublic.com February 3, 2009, accessed December 29, 2015.
12. Spetner, Information and mutation—Responding to David Levin.
13. Guliuzza, R. J. 2010. Fit & Function: Design in Nature. Acts & Facts. 39 (2): 10-11.
14. For an informative review of the important role of the RLN, see Bergman, J. 2010. Recurrent Laryngeal Nerve Is Not Evidence of Poor Design. Acts & Facts. 39 (8): 12-14.

* Dr. Guliuzza is ICR’s National Representative.

Cite this article: Randy J. Guliuzza, P.E., M.D. 2016. Major Evolutionary Blunders: The 'Poor Design' of Our Recurrent Laryngeal Nerve. Acts & Facts. 45 (4).
 

*참조 : 기린의 나쁜 디자인 -  (Youtube 동영상)  (‘되돌이 후두신경’이 형편없는 설계라고 주장하는 도킨스)

https://www.youtube.com/watch?v=cO1a1Ek-HD0

https://www.youtube.com/watch?v=Gf4Nx7Mw3E0



번역 - 미디어위원회

링크 - http://www.icr.org/article/9247

출처 - ICR, Acts & Facts. 45 (4), 2016.

구분 - 5

옛 주소 - http://www.kacr.or.kr/library/itemview.asp?no=6394

참고 : 6118|2978|6304|6302|6287|5774|6329|6373|6272|6236|6211|6160|6137|5920|5900|5856|5772|5665|5317|5173|5161|5113|4873

Jeffrey P. Tomkins
2016-06-01

정크 DNA가 기능이 있음이 또 다시 확인되었다. 

: 모티프라 불리는 DNA의 직렬반복과 유전자 발현 

(Junk DNA…Trashed Again)


     사람 유전체(human genome)에 들어있는 30억 개의 염기서열에서 반복되고 있는 '단어(word)'는 절반 이상이나 된다.[1] 언어에서 반복되는 단어는 오류로 보고 있기 때문에, 인간적인 생각으로 이러한 DNA 염기서열은 의미 없는 쓰레기(junk)로서 간주됐었다. 세속적 과학자들은 오랜 기간에 걸친 자연적 과정이 어떻게든 오류의 중복을 만들었고, 이러한 오류들이 쓸모없는 짐이 되어 유전체에 남아있어 전달되고 있다고 가정했었다. 그러나 이제 이러한 반복적인 단어들은 여러 생화학적 기능과 연결되어 있는 것으로 밝혀졌다.[1]


최근 뉴스에서 강조되고 있는, 사람 유전체(human genome) 염기서열에서 반복되고 있는 부분은 직렬반복(tandem repeats, TRs)이라 불리는 것이다. 이들은 모티프(motif)라 불리는, 머리-꼬리 패턴으로 배열된 '단어'의 두 개 또는 그 이상의 연속된 복사로 구성된 DNA의 확장 부분이다. 예를 들어, TR 'ttacttacttacttacgttac'은 단지 네 개의 모티프 'ttac'가 5회 반복되고 있다. 놀랍게도, 이러한 TRs는 유전자 안쪽, 바깥쪽, 심지어 유전자의 단백질 암호 부위 내부까지, 사람 유전체의 모든 부분에서 발견된다. 사람 각 개인별로 많은 TRs 들의 반복되는 길이는 다양하다. 그것은 법의학에서 범인이나, 친부모를 확인하는 데에 매우 효과적인 DNA 표지자(DNA markers)로서 사용되어왔다.


과학자들이 이 TR 시퀀스에 대해 알고 있었음에도 불구하고, 그리고 그것들을 신뢰할 수 있는 유전자 표지자로 사용해왔음에도 불구하고, 그것들의 실제적 기능에 대해서는 거의 알지 못하고 있었다. 언뜻 보기에 조금 이해되지 않는, 이들 비정상 같은 반복되는 염기서열 부분은 역사적으로 종종 ‘정크 DNA(junk DNA, 쓰레기 DNA)’로 취급되어 왔었다.


그러나 최근 한 그룹의 연구자들은 다른 접근 방식을 취했고, 이러한 서열이 어떤 목적을 가지고 있을 수도 있다는 가설을 세웠다. 그들은 유전자 발현과 DNA의 후성 유전학적 변화(epigenetic modification)에 있어서 TRs의 효과를 시험해보기 위한 실험 세트를 개발했다. 후성 유전학적 변화는 실제의 DNA 염기서열을 변경하지 않고, DNA 분자에 분자적 꼬리표(tags)를 추가하는 것이다. 그 결과 유전자 발현(gene expression)이 변경된다.


현재의 그리고 새롭게 얻어진 일련의 데이터들을 사용한 광범위한 실험을 실시한 후에, 연구자들은 ”우리의 결과는 사람 유전체에 있는 수천의 TR 변이들이 아마도 국소적 유전자 발현의 변경, 또는 후성유전학(epigenetics)을 통해서 기능적 효과를 발휘하고 있을 가능성을 제시한다”고 선언했다. 그들은 또한 이렇게 말했다 :

우리의 연구는 사람 유전체에서 TR 변이(TR variations)의 생물학적 중요성을 보여주고 있다. 그리고 TR 변이의 상당 부분이 국소적 유전자 발현이나, 후성유전학의 변경을 통해서 기능적 효과를 발휘하고 있음을 제시한다. 우리는 유전체에서 완전한 기능적 변화를 확인하기 위해서, 유전자형(유전자 시험) TR 변이에 초점을 맞춘 연구들이 필요하다는 결론을 내린다.[1]

이러한 새로운 데이터는 인간의 질병과 관련한 TRs의 기능적 역할에 대한 증거들을 밝혔던 다양한 이전 연구들을 확증해주고 있었다. 이것이 입증됨으로서, 수십 가지의 사람의 유전질환들은 유전체의 단백질 암호 또는 비암호 부위에서 커다란 반복적 확장과 직접적으로 연결되어 있을 수 있다.[2] 분명히, 이들 부위는 엄격한 유전적 조절 하에 있다. 그러한 반복이 허용되는 변이의 길이 한계를 넘었을 때, 질환이 생기는 결과를 초래할 수 있다.


다시 한 번 우리는 유전체에서, 한때 과학자들이 그 기능을 알지 못한다는 사실 만으로, 진화 도중에 남겨진, 기능이 없는 정크(쓰레기)라고 불렀던 DNA의 부분들이 분명한 기능들을 가지고 있다는 사실을 확인할 수 있었다. 진화론자들은 이해하지 못하고 알지 못하는 부분들에 대해서 적절한 답을 가지고 있는 것처럼 추정적인 이야기들을 남발해 왔었다.  


유전체 연구에 있어서, 지적설계에 기초한 접근 방식이 더 널리 받아들여졌었다면, 현재에도 알지 못하는 기능들에 대한 우리의 이해가 얼마나 많이 발전해 있었겠는가? 그러한 시도들은 초월적 지혜를 가지신, 위대한 설계자이자 공학자이신, 창조주 하나님께 영광을 돌렸을 것이다.



References

1. Quilez, J. et al. 2016. Polymorphic tandem repeats within gene promoters act as modifiers of gene expression and DNA methylation in humans. Nucleic Acids Research. 44 (8): 3750-3762.
2. Gemayel, R., M. D. Vinces, M. Legendre, and K. J. Verstrepen. 2010. Variable tandem repeats accelerate evolution of coding and regulatory sequences. Annual Review Genetics. 44: 445-477.

*Dr. Tomkins is Director of Life Sciences at the Institute for Creation Research and earned his Ph.D. in genetics from Clemson University.



번역 - 미디어위원회

링크 - http://www.icr.org/article/9352

출처 - ICR News, 2016. 5. 26.

구분 - 4

옛 주소 - http://www.kacr.or.kr/library/itemview.asp?no=6389

참고 : 6361|5928|5704|4780|4810|4710|4200|4182|3892|6321|6126|6319|6274|6207|6148|6003|6000|5970|5950|5954

Jeffrey P. Tomkins
2016-05-30

고릴라 유전체 분석에서의 진화론적 편견 

(Monkey Business in the New Gorilla Genome)


      오랫동안 내려온 진화론적 가정(assumptions)은 좀처럼 깨지기 어려워 보인다. 사람 유전체(human genome)를 기초로 실시된 최근의 원숭이 DNA 염기서열 분석은 한 좋은 사례가 되고 있었다. 이 새로운 고릴라 유전체 연구는 발달된 DNA 시퀀싱 기술을 사용했음에도 불구하고, 오래된 병폐를 동일하게 보여주고 있었다.[1] 유전체 분석의 정확성이 진화론적 방법에 의해서 명백히 오염되고 있는 것이었다.


유전체(염색체의 완전한 세트) 염기서열이 분석될 때, DNA는 작은 부분으로 분석되고, 함께 이어져 맞춰진다. 지난 20년 이상 동안, 다른 다양한 기술들이 각 DNA 염기서열, 길이 약 100~1500 염기들을 읽어냈다. 사람과 원숭이의 유전체 염기서열 길이가 대략 30억 개라는 것을 고려하면, 이렇게 읽혀진 짧은 부분들을 연속적인 염색체의 큰 부분으로 조립하여 분석하는 일은 어려운 작업이다.


과거에 실시됐던 (사람의 진화론적 친척으로 추정하는) 침팬지, 고릴라, 오랑우탄 등에 대한 연구 프로젝트들에서, 해독된 DNA 염기서열은 그 길이가 항상 짧았고, 연구비가 꽤 제한되어 있었다. 그래서 과학자들은 비계(scaffold, 발판), 또는 지표(guide)로서 사람 유전체(genome)를 사용하여, 원숭이의 짧은 DNA 염기서열들을 모아 읽는 것이 편리하다는 것을 발견했다. 이것은 원숭이의 유전체가 사람처럼 보이도록 하는 편향된 결과를 만들어냈다.[2]


이제 SMRT(Single-Molecule Real-Time sequencing technology, 단일분자 실시간 염기서열분석기술)이라는 새로운 DNA 시퀀싱 기술은 1만 개 이상의 염기서열들을 읽을 수 있게 되면서, 유전체의 조립 공정이 기준 비계에 덜 의존하게 되었다. 하지만 오래된 습관은 깨지기 힘들어 보인다. 특히 그 결과가 진화론과 일치하지 않을 때 말이다.[3]


SMRT을 사용하여, 레퍼런스 염기서열의 사용 없이, 오버랩에 기초하여 서로 서로 그 위에 조립하는 방식인 ‘디 노보 어셈블리(de novo assembly, 신규 조립)’라 불리는 방법으로, 최초로 고릴라 유전체를 길게 읽는 염기서열의 재-시퀀싱이 이루어졌다.[1, 4] 하지만 불행하게도, 그것이 그 이야기의 끝이 아니었다. contigs 또는 scaffolds로 불려지는, 새로이 모여진 인접 염기서열의 부분들은 더 많이 모여졌고, 비계로서 사람 유전체를 사용하여 편집되었다. 그 프로젝트의 저자들은 말했다. ”우리는 그것들을 GRCh38(인간 유전체의 현재 버전)로 정렬시킴으로서 비계의 정확성을 평가하였다.” 그리고 ”염색체 해상도를 제공하기 위해서 비계는 GRCh38를 사용하여 더욱 정렬되고 순서화되었다.”[4] 그래서 그들은 염기서열 조각들로부터 고릴라 유전체를 구축하는 것을 시작했다고 하지만, 최종 결과물을 수정하기 위해서 아직도 진화론적 표준으로서 사람 유전체를 사용하고 있었던 것이다.


보다 정확한 고릴라 유전체를 얻기 위해서 고상하고 객관적인 노력으로 시작한 것이, 오래된 진화론적 편견에 의해 뒤죽박죽으로 끝나버렸다. 이것은 과학적 방법론에 주관적 편견이 개입되고 있음을 명백히 보여주는 것이다.


그럼에도 불구하고 모여진 DNA 염기서열이 표준 진화론적 관행(고릴라 유전체가 실제보다 더 사람에 가깝게 보이도록 하는 행위)의 적용 단계 이전에 대중들에게 공개된다면, 창조과학자나 세속과학자 모두 연구해 볼 수 있는 많은 보강된 자료들을 가지게 될 것이다. 나는 그 분석된 최초 염기서열들을 살펴볼 수 있기를 기대한다.



References

1.Gordon, D. et al. 2016. Long-read sequence assembly of the gorilla genome. Science. 352 (6281): 52, DOI: 10.1126.
2.Tomkins, J. P. 2011. How Genomes Are Sequenced and Why It Matters: Implications for Studies in Comparative Genomics of Humans and Chimpanzees. Answers Research Journal. 4: 81-88.
3.Tomkins, J. P. 2016. A More Accurate Chimpanzee Genome. Acts & Facts. 45 (4): 9.
4.Gordon, D. et al. 2016. Supplementary Material for Long-read sequence assembly of the gorilla genome. Science. 352 (6281): 52, DOI: 10.1126.

*Dr. Tomkins is Director of Life Sciences at the Institute for Creation Research and earned his Ph.D. in genetics from Clemson University.



번역 - 미디어위원회

링크 - http://www.icr.org/article/9300

출처 - ICR News, 2016. 4. 18.

구분 - 4

옛 주소 - http://www.kacr.or.kr/library/itemview.asp?no=6388

참고 :

Jeffrey P. Tomkins,
2016-04-12

유전체 내 바이러스성 정크의 기능이 발견되다. 

(Viral Genome Junk Hits the Trash)


     진화론자들은 사람의 염색체는 수백만 년에 걸쳐 여러 다른 바이러스들에 감염되었고, 유전체 내에서 증대되었다고 주장해왔다. 그리고 DNA에서 바이러스의 것처럼 보이는 몇몇 부분이 기능이 있는 것으로 보여지면서, 진화론자들은 그것은 야생동물이 가축화된 것처럼, 길들여진 것이라고 주장했다. 바이러스 같은 DNA가 처음 발견되었을 때, 그들 중 대부분은 쓸모없는 쓰레기(junk, 정크)로 입증될 것이라고 (지금까지도) 생각했었다.


내인성 레트로바이러스(ERVs, endogenous retroviruses)라 불리는 DNA 염기서열은 포유동물의 유전체(genomes)에 풍부하다. 그 염기서열이 초기에 그러한 이름을 얻게 된 것은, 그들이 알려진 바이러스와 매우 유사한 염기서열을 보였기 때문이었다. 진화론자들은 동물 유전체는 바이러스에 의해 반복적으로 감염됨으로서, 부분적으로 현재 상태로 진화되었다고 주장했다. 그것은 처음에는 생물체의 '정크' DNA의 한 부분으로 간주됐었다.

ERVs에 대한 연구가 발전됨에 따라, 이들 유전체의 많은 부분들이 정크가 아니라, 태반의 발달과 같은 포유동물의 생존에 중요하다는 것이 밝혀지고 있다.[1] 그리고 많은 다른 ERVs들도 세포 유형에 의해서 특별히 조절되는 것이 발견되었다.[2] 이들 ERVs는 유전자를 제어하는 조절 단백질(전사인자)들과 결합함으로서, 유전체에서 유전자 스위치처럼 행동하는 특별한 염기서열을 포함하고 있었다.[2]


이제 새로운 한 연구는 유전체에 걸쳐 있는 다른 많은 ERVs들이 면역반응과 포유동물의 생존에 필요한 다른 중요한 과정들을 제어하는데 중요한 역할을 하고 있음을 보여주었다.[3] 특히 이 새로운 연구는 ERVs가 감염 시에 분비되는 염증유발 신호분자를 만드는 유전자를 조절하고 있음을 보여주었다. 이 중요한 시스템은 선천성 면역반응이라 불리는 것으로, ERVs에 의해서 조절되는 유전자들은 선천성 면역인자(innate immunity factors)로 불리는 생물학적 네트워크와 연관되어 있었다. 이들 유전자와 관련된 ERV 요소들을 실험실에서 불활성 시켰을 때, 선천성 면역인자의 생산은 중단되었다. 우아한 실험은 그 상관관계를 명확하게 입증했다. 그들의 유전체를 제어하는 ERVs가 없다면, 분명 포유동물은 병들게 될 것이고, 생존하기 어려웠을 것이다.  

최근 기사에서 나는 ERVs에 대한 자세한 사항과, 유전체에서 그들의 존재를 설명하는 진화 이야기가 완전히 잘못 되었음을 기술했다.[4] 간단히 말하면, 이들 ERVs는 장구한 시간 동안에 수많은 바이러스들이 감염되어 일어난 결과가 아니라, 원래부터 창조된 각 생물의 유전자 청사진의 일부라는 것이다. 나와 다른 여러 창조 연구자들이 제안했던 것처럼, ERVs는 사람과 여러 종류의 동물에서 하나님이 만드신 원래의 유전체 청사진의 일부였으며, 외부적 바이러스성 유전체는 아담의 죄로 인해 하나님이 피조물에 내리신 저주 이후에, 사람과 동물의 ERVs에서 파생되었을 가능성이 매우 높다. 변성과 쇠퇴의 과정이 시작됐지만, 아직도 그 분의 놀라운 솜씨는 완전한 기능적인 유전체에서 여전히 볼 수 있는 것이다.



References
1. Lavialle, C. et al. 2013. Paleovirology of 'syncytins', retroviral env genes exapted for a role in placentation. Philosophical Transactions of the Royal Society B. 368 (1626): 2012.0507.
2. Pavlicev, M. et al. 2015. Detecting endogenous retrovirus-driven tissue-specific gene transcription. Genome Biology and Evolution. 7 (4): 1082-1097.
3. Chuong, E. B., N. C. Elde, and C. Feschotte. 2016. Regulatory evolution of innate immunity through co-option of endogenous retroviruses. Science. 351 (6277): 1083-1087.
4. Tomkins, J. P. 2015. Viral Genome Junk Is Bunk. Acts & Facts. 44 (4): 12.

*Dr. Tomkins is Director of Life Sciences at the Institute for Creation Research and received his Ph.D. in genetics from Clemson University.

 


번역 - 미디어위원회

링크 - http://www.icr.org/article/9253

출처 - ICR News, 2016. 4. 4.

구분 - 4

옛 주소 - http://www.kacr.or.kr/library/itemview.asp?no=6363

참고 : 6361|5474|4366|5704|5928|5456|2765|6207|6126|6000|6009|5944|5913|5838|5793|5787|5734|5655|5580|5558|5514

Jeffrey P. Tomkins
2016-04-08

유전체 내의 바이러스성 정크라는 허튼 소리

(Viral Genome Junk Is Bunk)


       진화론의 진행되고 있는 신화(myths) 중 하나는 동물과 인간의 유전체(genomes) 내에는 많은 량의 바이러스성 DNA가 화석처럼 산재되어 존재한다는 것이다. 이러한 주장되는 고대의 바이러스성 염기서열은 바이러스 감염을 통해서 유전체 내로 들어온 것으로 생각하고 있다. 처음에는 숙주에 어떠한 역할도 제공하지 않았으나, 나중에 진화의 느리고 긴 변화 동안에, 정교한 인간 생식 과정에 도움을 주는 것과 같은, 아마도 다양한 유용한 목적으로 전환(허용)되었다는 것이다. 그러나 유전체학(genomics) 분야의 지속적 발전은 다른 진화 이야기들처럼 이 대중적 진화 이야기를 완전히 기각시키고 있었다.  


진화론에 따르면, 바이러스는 과거 1억년 이상의 포유동물의 진화 동안에 반복적으로 생식세포(난자와 정자를 만드는)의 DNA 안으로 통합되어졌다는 것이다. 그래서 그들의 바이러스성 DNA를 생물의 유전체를 가로지르며 증식시켰다는 것이다.[1] 이들은 ‘내인성 레트로바이러스 (endogenous retroviruses, ERVs)’ 염기서열이라 불린다. 그리고 사람 유전체의 8%가 이들 염기서열로 채워졌다는 것이다. 그러나 이러한 아이디어에는 적어도 세 가지 주요한 문제점들이 존재한다.


첫째, 유전자 데이터는 이들 염기서열이 수백만 년 되지 않았음을 나타낸다. 진화유전학의 비교 도구를 사용하여, 세속적 과학자들은 동물의 유전체에서 대응하는 바이러스의 유전자 염기서열을 비교했고, 그 결과 이러한 서열의 변화는 기껏해야 50,000년 이상 될 수 없음을 가리켰다.[2] 따라서 이들 바이러스 같은 염기서열이 수백만 년이 되지 않았다면, 그들은 어디에서 왔다는 말인가?


둘째, ERV 염기서열이 동물의 생식세포 내로 안정적으로 통합되었을 것이라고 주장되는 과정은 결코 문헌으로 보고된 적이 없다. 그 과정 자체가 추정인 것이다. 신체 세포(체세포 조직이라 불리는)에서 그러한 무작위적인 통제되지 않은 통합이  발생했을 때에는, 그것들은 종종 암을 유발시킨다.[1] 실제로, 가장 현대적 ERV 같은 바이러스도 쉽게 호스트의 유전체 내로 통합되지 않는다. 단지 AIDS 바이러스와 같은 소수의 바이러스만이 이렇게 하는 것이 발견됐다. 그리고 이러한 통합의 형태를 수행하는 것들은 다음 세대로 그것을 전달해줄 수 있는 생식세포를 표적으로 하지 않는다.  


셋째, 포유류 유전체의 ERV 염기서열에서 중요한 기능이 있음이 확인되고 있다. 사실, 최근의 몇몇 연구에 의하면, 태반 발달 및 유지(번식과 생명에 있어서 중요한 과정)에 있어서 많은 ERV 유전자 염기서열이 중요한 역할을 하고 있음을 보여주었다.[3, 4] 이들 염기서열에 포함된 중요한 유전자들뿐만 아니라, 많은 다른 조절 인자들이 유전자 스위치의 핵심적 기능을 수행하고 있었다.[5]


그러면 그들의 숙주 유전체에서 발견되는 것과 같은 염기서열을 공유하는 바이러스는 어디에서 온 것일까? 여러 창조과학자들이 제안했던 것처럼, 아마도 진화론자들은 수레를 말 앞에 두고 있는 것처럼 보인다.[4, 6] 사실 아이러니하게도, 위에서 언급된 증거들은 숙주 유전체에 바이러스가 통합된 것이 아니라, 그들 바이러스는 숙주로부터 생겨났음을 가리키는 것이다. 분자생물학자이며 생화학자인 피터 보거(Peter Borger)는 쓰고 있었다 : ”가장 간결한 대답 : RNA 바이러스는 그들의 유전자를 숙주로부터 얻었다.”[6]


다른 말로 해서, 포유류 바이러스는 저주(Curse) 이전에는 전혀 존재하지 않았다. 아마도 아담의 범죄 이후, 지구상에 있던 사람과 동물에 이미 있던 DNA 서열로부터 발달되었을지 모른다. 첨단 유전체 연구는 기원에 관한 창세기의 설명을 확증해주고 있는 것이다.



References

1.Magiorkinis, G., D. Blanco-Melo, and R. Belshaw. 2015. The decline of human endogenous retroviruses: extinction and survival. Retrovirology. 12: 8.
2.Holmes E. C. 2003. Molecular Clocks and the Puzzle of RNA Virus Origins. Journal of Virology. 77 (7): 3893–3897.
3.Lavialle, C. et al. 2013. Paleovirology of ‘syncytins’, retroviral env genes exapted for a role in placentation. Philosophical Transactions of the Royal Society. 368 (1626): 20120507.
4.Liu, Y. and C. Soper. 2009. The Natural History of Retroviruses: Exogenization vs. Endogenization. Answers Research Journal. 2: 97–106.
5.Chuong, E. B. et al. 2013. Endogenous retroviruses function as species-specific enhancer elements in the placenta. Nature Genetics. 45 (3): 325-329.
6.Borger, P. 2009. The design of life: part 3—an introduction to variation-inducing genetic elements. Journal of Creation. 23 (1): 99-106.

* Dr. Tomkins is Research Associate at the Institute for Creation Research and received his Ph.D. in genetics from Clemson University.


번역 - 미디어위원회

링크 - http://www.icr.org/article/viral-genome-junk-bunk

출처 - ICR, Acts & Facts. 44 (4).

구분 - 4

옛 주소 - http://www.kacr.or.kr/library/itemview.asp?no=6361

참고 : 5474|6207|6366

하주헌
2016-02-24

돈돈돈 쓰쓰쓰 돈돈돈


      1912년 4월 15일 0시 5분, 다급하게 전송된 신호 ··· ――― ···를 수신한 카르파티아호는 전속력으로 항해하여 90 km 떨어진 좌표 지점에 약 4시간만인 03시 55분경에 도착하였으나, 그 곳은 이미 1513 여명의 희생자가 발생한 후였고, 말로 표현할 수 없는 처참한 상황에서 생존한 711명만 가까스로 구조할 수 있었다. 당시 생존자의 증언에 따르면 영하2도인 바닷물에 뛰어들었을 때는 수천 개의 날카로운 칼이 온 몸을 찌르는 듯한 고통을 느꼈다고 한다. 

 

불과 나흘전인 1912년 4월 10일, 영국 사우샘프턴을 떠나 뉴욕을 향해 처녀항해를 하던 당시 최고 최대를 자랑하던 호화여객선 타이타닉호는 4월 14일 23시 40분 빙산과 충돌하였다. 타이타닉은 침몰할 수밖에 없는 상황이라고 판단한 선장 에드워드 스미스는 4월 15일 0시 5분, 조난 신호인 ··· ――― ··· (돈돈돈 쓰쓰쓰 돈돈돈)를 보내게 된다. 결국 타이타닉은 충돌 후 2시간 40분여만인 4월 15일 02시 20분에 완전 침몰하게 된다.


타이타닉호에서 발신한 조난 신호는 모스 부호로 이루어진 것이다. 모스 부호는 문자 정보를 짧은 발신 전류 (·)와 긴 발신 전류(―)의 조합으로 전송하는 무선 통신 방법이다. 이 조합 중 가장 간단명료한 조합인 ···(S)와 ―――(O)를 이용하여 SOS를 조난 신호로 사용하기로 1906년 결정되었고, SOS는 1912년 4월 15일 타이타닉호에 의해 최초로 사용되었다. 물론 SOS는 전파뿐 아니라 소리, 빛, 색깔 등 다양한 매개체를 이용하여 전달될 수 있다. ‘조난’이라는 ‘정보’가 매개체인 다양한 ‘물질’에 담겨져서 전달되는 것이다. 이 과정에서 정보는 철저한 규칙에 의해 존재한다는 사실을 알 수 있다.


만약 '··· ――― ···”이 사전에 정해진 약속에 따른 규칙이 없다면, 이 신호가 무엇을 의미하는지 보내는 사람도 받는 사람도 알지 못하는 무의미한 잡음이 될 뿐이다. 또한 타이타닉호의 711명도 카르파티아호에 의해 구조되지 못했을 것이다. 비슷한 예로 시각 장애인을 위해 개발된 점자는 문자 정보를 종이, 금속, 나무 등 다양한 물질의 요철 형태를 이용하여 전달하며, 이 과정에도 철저한 규칙이 있어야만 정보가 전달 될 수 있다. 정보는 정해진 규칙에 따라 물질의 한 형태로 다른 사람에게 전달되고, 그 사람은 전달된 물질을 보고 그 규칙에 따라 정보를 획득하게 된다. 즉 정보는 물질에 아무런 규칙이나 방향성 없이 우연하게 존재하는 것이 아니라 사전에 철저하게 약속된 규칙이 존재하고, 그 규칙에 따라 정보를 보내고 받는 시스템이 존재해야 하는 것이다. 


생명체내의 모든 ‘정보’는 DNA라는 ‘물질’에 담겨 다음 세대로 전달된다. 모든 생명체는 DNA안에 들어있는 규칙에 따라서 정보를 주고받으며, 이러한 정보가 살이 되고 피가 되고, 이러한 정보에 의해 자녀들이 부모를 닮게 된다. 과연 생명 유지를 위해서 도대체 얼마나 많은 정보가 필요할까? 지난 50여 년간 자연과학자들은 DNA안에 숨겨져 있는 규칙을 알고자 수많은 연구를 거듭해 오고 있지만, 연구를 하면 할수록 얻는 결론은 DNA 정보가 생명현상을 만드는 규칙은 너무나 복잡하고 신묘막측하다는 것이다. 이제는 인간의 능력으로 DNA 정보의 본질을 절대로 다 알 수 없다고 고백하고 있다. 


하나님을 믿지 못하는 사람들은 DNA가 우연히 정보를 만들었다고 주장하지만, 정보는 물질이 만들 수 있는 것이 아니다. 도리어 물질에 정보가 심겨진 것이다. 누가 DNA를 활용하여 정보를 심었고, 이 방대한 정보량을 전달할 수 있는 시스템을 만들었는가? 유전정보를 연구하는 과학자의 한 사람으로서 DNA를 볼 때마다 정보를 창조하시고, 시스템을 설계하신 창조주 하나님의 지혜와 능력 앞에서 겸손해질 뿐이다. 



구분 - 3

옛 주소 - http://www.kacr.or.kr/library/itemview.asp?no=6331

참고 : 6266|5954|5949|5947|5540|5454|4672|4210|3373|3358|3293

Jeffrey P. Tomkins
2016-02-05

후성유전학적 암호는 이전의 생각보다 훨씬 더 복잡했다. 

(Epigenetic Code More Complicated Than Previously Thought)


     진화론의 예측과는 완전히 모순되게, 유전체 내에 들어있는 언어 시스템은 상상할 수 없을 정도의 초고도 복잡성을 가지고 있음이 계속적으로 밝혀지고 있다. '최근 케임브리지 대학 연구자들의 발견에 의하면, (DNA에 부착되어 있는 분자 스위치들이 유전자들을 켜고 끄는) 후성유전학(epigenetics)의 세계에서 새로운 타입의 후성유전학적 변경(modification)을 발견했다.”[1]

유전체(genome, 게놈) 연구에서 가장 흥미롭고 빠르게 확장되고 있는 분야중 하나는 ‘후성유전학(epigenetics)’이라는 분야이다. 후성유전학이라는 단어는 그리스어의 접두사 ‘epi’ 로부터 왔는데, 그것은 ‘~의 위에(on top of)’를 의미한다. 다른 말로 그것은 DNA 암호 위에 쓰여져 있으면서, 유전자들이 어떻게 스위치를 켜고 끄는지를 도와주는, 유전체 언어의 부가적인 형태이다. 후성유전학은 가령 식사와 흡연과 같은, 우리의 환경적, 행동적 특성이 우리의 유전체에 어떤 영향을 주는지, 그리고 이러한 많은 변화들이 어떻게 우리의 자녀들과 후손들에게 전달되어 유전될 수 있는지, 그래서 특성들이 어떻게 영향을 받는 지에 대한 하나의 설명이 되고 있다.

과학자들은 DNA의 기능적 화학이 변화되면서 일어나는 변경과, 유전자 암호를 구성하고 있는, 남아있는 변경되지 않는 염기쌍 서열들을 연구하며, DNA를 분석함으로써 후성유전학을 연구하고 있다.

한 생물체의 DNA는 두 가지의 후성유전학적 방법으로 변경될 수 있다. 첫째, 화학적 그룹이 실제적 DNA 염기 분자, 또는 뉴클레오타이드 철자에 추가되는 것이다. 둘째, DNA와 통합되어있는 히스톤(histones)이라 불리는 단백질이 다른 많은 방법으로 변경되는 것이다. 이러한 두 타입의 DNA 변경은 모두 DNA와 결합하는 단백질의 DNA 접근성을 결정하고, 유전자 활성을 조절하거나 통제하는데 도움을 주고 있다.

후성유전학적 변경은 후성유전학적 꼬리표(tags)를 추가하거나 제거하는, 광범위하게 다양한 특수한 세포 기계들에 의해서 고도로 조절된다. DNA 분자 위에, 또는 히스톤 단백질 위에 존재하는 이들 꼬리표의 존재는 다양한 유전자들이 발현되는, 즉 유전자들이 켜지거나 꺼지는 방식에 있어서 중요한 역할을 수행한다. 사실 사람의 많은 질병들은 정상적인 건강한 유전체 측면이 아닌, 후성유전학적 변화와 관련이 있다.

후성유전학을 연구하는 데에 있어서의 한 문제점은 그것의 압도적인 복잡성과 관련되어 있다. 유전암호는 뉴클레오타이드의 철자 A, C, T, G의 정렬된 순서로 이루어져 있다. 그러나 히스톤 암호(histone code)는 100개 이상의 다른 철자(화학적 꼬리표)들을 가지고 있다. DNA 자체의 후성유전학적 암호는 오히려 훨씬 더 간단하다고 생각된다. 유일한 주요한 변경은 하나의 메틸그룹(methyl group)이 시토신(cytosine)에 부착되는지 여부에 달려있는 것처럼 보인다. 그러나 이 새로운 발견은 이전의 믿어졌던 것보다, DNA의 더 많은 변경이 사람, 쥐, 다른 척추동물에서 존재하고 있음을 가리킨다.[2]

연구자들은 유전체로부터 유전자들의 복사체나 전사체인, RNA 분자로 이루어진 변경을 분석하다가 이 새로운 발견을 우연히 찾아냈다. 그들은 RNA가 시토신(cytosines, C)과 반대되어, 아데닌(adenines, A)에 자주 부착되어 있는 메틸그룹이 있다는 것을 알게 되었다. 이제 연구자들은 DNA의 아데닌이 또한 후성유전학적 꼬리표로서 그들과 부착하는 메틸그룹을 가지고 있음을 발견했다. 선임연구자인 코지올(Koziol) 박사는 말했다. '우리는 우리의 DNA를 직접적으로 조절하는 훨씬 더 많은 변경이 있을 수 있다고 믿고 있다. 이것은 후성유전학 분야의 새로운 장을 열수 있다.”[1]

DNA에서 이 새로운 유전자 암호의 존재는 시토신 메틸화 보다 그렇게 흔하지는 않지만, 이 후성유전학적 꼬리표의 예상치 못했던 언어적 복잡성은 결코 단순한 것이 아니었다. 이러한 시스템은 목적도 없고 방향도 없는 무작위적인 자연적 과정으로는 절대로 생겨날 수 없는 것이다. 과학적 발견들이 유전체학(genomics,)의 발전을 이끌면서, 유전체와 그것에 들어있는 다양한 언어들의 막대한 수준의 초고도 복잡성은 이것이 초월적 지적설계자에 의해 설계된 생물공학임을 가리키고 있는 것이다. 


References

1.Epigenetic discovery suggests DNA modifications more diverse than previously thought. University of Cambridge News. Posted on cam.ac.uk December 21, 2015, accessed January 15, 2016.
2.Koziol, M. et al. 2016. Identification of methylated deoxyadenosines in vertebrates reveals diversity in DNA modifications. Nature Structural & Molecular Biology. 23 (1): 24-30.

*Dr. Tomkins is Research Associate at the Institute for Creation Research and received his Ph.D. in genetics from Clemson University.


번역 - 미디어위원회

링크 - http://www.icr.org/article/9178 

출처 - ICR News, 2016. 1. 28.

구분 - 4

옛 주소 - http://www.kacr.or.kr/library/itemview.asp?no=6321

참고 : 6126|5762|5655|5994|5918|5730|5474|6003|5900|6148|6207|6134|6274|5883|6000

Jeffrey P. Tomkins
2016-02-02

사람과 침팬지의 유전자 차이는 더욱 커졌다 

: 각 생물에만 있는 고아유전자들은 진화론을 거부한다. 

(Genetic Gap Widens Between Humans and Chimps)


     한 생물에만 독특하게 있는 고아유전자(orphan genes)들이 점점 더 많이 발견되면서, 이들 유전자들은 진화론을 거부하고 성경의 창조를 더욱 지지하는 증거가 되고 있다. 이들 유전자들은 특정 생물의 특별한 암호 염기서열을 갖고 있는 독특한 유전자 세트이다. 이것은 진화론이 설명할 수 없는 커다란 문제가 되고 있다. 최근의 한 연구 보고서에서, 과학자들은 사람과 침팬지 사이에 완전히 다른 1,307개의 새로운 고아유전자 세트를 보고하고 있었다.[1]


이름이 의미하는 것처럼, 고아유전자는 다른 타입의 생물에서는 발견되지 않는다. 그러므로 어떠한 진화론적 역사도 가지고 있지 않다. 이 발견은 창조모델에서는 또 하나의 주요한 예측이 되고 있다. 유사한 기능을 가진 생물들은 유사한 암호를 가지고 있을 뿐만 아니라, 또한 그들은 다른 생물체와는 구별되도록 해주는 독특한 유전자 암호들을 가지고 있다. 과학자들은 이러한 창조론적 예측을 지지하면서, 고아유전자들은 특별한 생물학적 과정과 특별한 적응과 관련된 특성에서 믿을 수 없도록 중요하다는 것을 발견해오고 있다. 이전에 보고됐던 ICR 뉴스의 여러 글들은 제브라 피쉬와 꿀벌에서 발견됐던 이러한 타입의 고아유전자들을 기술해 왔었다.[2, 3]


유사한 몸체 형태를 가지는 많은 생물들은 유사한 생물학적 특성들을 공유하고 있으며, 유사한 일련의 핵심 유전자들을 가지고 있다. 진화론자들은 이것이 공통조상의 증거라고 주장한다. 그러나 창조론자들은 더 분명하고 효율적인 설명을 제안한다. 그러한 유사한 공통 유전자들은 동일한 환경을 공유하는, 유사한 요구성을 필요로 하는 생물들의 유전체(genome) 내에 들어있는 의도적인 공학적 시스템에서 예측되는 모습이라는 것이다. 그것은 마치 다른 소프트웨어 프로그램에서 공통 암호 조각을 사용하는 컴퓨터 프로그래머와 같은 것이다.


또 다른 최근의 연구 보고에서, 과학자들은 사람에서 634개의 독특한 고아유전자들을 발견했고, 침팬지에서는 780개의 독특한 고아유전자들을 발견했음을 보고했다.[1] 다른 말로 해서, 이제 사람과 침팬지 사이에는 완전히 다른 1307개의 새로운 세트의 유전자들이 존재한다는 것이다. 사실 침팬지에 있는 특별한 유전자들은 짧은 꼬리 원숭이(macaque)나 멸종 원숭이 등과 같은 어떤 다른 침팬지 조상 추정 생물에서 발견되지 않고 있다. 사람의 고아유전자가 사람에게만 독특하게 있는 것처럼, 그 유전자들은 침팬지에게만 독특하게 존재한다. 다윈의 진화론은 이러한 놀라운 발견을 예측하지 못했다.


본질적으로 고아유전자라는 진화론의 약점을 노출하면서 연구자들은 이렇게 말했다 : ”지난 20년 동안 과학자들은 한 이상한 보편적인 유전적 현상에 대해 이해하지 못하고 있어왔다. 모든 각 유전체(genome) 내에는 특별한 생물 종에만 있는, 즉 어떤 다른 생물 종과 상동성이 결여된, 독특한 유전자 세트들이 존재하고 있다.”[1]


이들 새로 발견된 고아유전자들에 관한 또 다른 흥미로운 사실은, 발견된 고아유전자들은 침팬지 또는 사람의 독특한 유전자들 중에서 단지 일부분에 불과하다는 것이다. 연구자들은 단지 간, 심장, 뇌, 고환에서 발현되는 유전자들만을 분석했다. 몸체 조직의 다른 많은 부분들은 아직 조사되지 않았다. 따라서 아직 더 많은 고아유전자들이 발견될 것이 예상된다. 더군다나 연구팀은 RNA 전사체가 DNA로부터 복사된 이후에 잘려진 암호 부분을 가지는 스플라이싱이 일어난 유전자들만을 분석했다. 유전체 내에 있는, 스플라이싱이 일어나지 않은, 다른 많은 유전자들은 이 연구에서 포함되지 않았다. 말할 필요도 없이, 과학자들이 사람과 침팬지 사이에서 발견하고 있는 수많은 유전자들 차이는, 사람과 침팬지가 공통조상을 갖고 있다는 다윈의 진화론을 완전히 부정하고 있는 것이다.


놀라운 각 생물들의 고유 특성들과 이들 고아유전자들은 진화론에 도전하고 있을 뿐만 아니라, 그것들은 창조론자들이 창조된 종류(created kinds)와 관련된 유전체 구조 패턴을 이해하는데 도움을 주고 있다. 사람과 침팬지 사이의 분명한 유전적 차이는 커다란 스케일에서 진화론을 부정하고 있으며, 고아유전자들의 존재는 사람이 하나님의 형상을 따라 독특하게 창조되었음을 다시 한 번 증거하고 있는 것이다.



References

1.Ruiz-Orera, J. et al. 2015. Origins of De Novo Genes in Human and Chimpanzee. PLoS Genetics. 11 (12): e1005721.
2.Tomkins, J. 2013. Newly Discovered 'Orphan Genes' Defy Evolution. Creation Science Update. Posted on icr.org August 26, 2013, accessed January 4, 2016.
3.Tomkins, J. 2015. Honey Bee Orphan Genes Sting Evolution. Creation Science Update. Posted on icr.org February 19, 2015, accessed January 4, 2016.

*Dr. Tomkins is Research Associate at the Institute for Creation Research and received his Ph.D. in genetics from Clemson University.

 

*관련기사 : 침팬지와 인간 DNA의 98%가 같다고?- 진화론의 무지가 낳은 무지 (2017. 1. 5. 기독일보)



번역 - 미디어위원회

링크 - http://www.icr.org/article/9145

출처 - ICR News, 2016. 1. 21.

구분 - 4

옛 주소 - http://www.kacr.or.kr/library/itemview.asp?no=6319

참고 : 5731|6105|5510|5863|6243|5847|5496|5952|5702|5458|5226|4824|4831|4315|4736|2065|4821|6138|5667



서울특별시 종로구 창경궁로26길 28-3

대표전화 02-419-6465  /  팩스 02-451-0130  /  desk@creation.kr

고유번호 : 219-82-00916             Copyright ⓒ 한국창조과학회

상호명 : (주)창조과학미디어  /  대표자 : 박영민

사업자번호 : 120-87-70892

통신판매업신고 : 제 2021-서울종로-1605 호

주소 : 서울특별시 종로구 창경궁로26길 28-5

대표전화 : 02-419-6484

개인정보책임자 : 김광