LIBRARY

KOREA  ASSOCIATION FOR CREATION RESEARCH

창조설계

Walt Brown
2004-04-30

유전 정보 

(Genetic Information)


     사람 세포 각각의 DNA에 들어있는 유전정보는 4,000 권의 책이 있는 도서관의 정보의 양과 동일하다.1 물질과 생명체(아마도 한 마리의 박테리아)가 어떻게든지 발생했다손 치더라도, 돌연변이와 자연선택으로 이러한 방대한 양의 정보가 만들어질 수 있는 가능성은 원천적으로 제로이다.2 4,000 권의 책이 만들어지기까지, 다음과 같은 과정들이 계속 일어났을 것이다.3

1) 의미없는 문장들이 만들어지기 시작한다.

2) 이 문장들을 복사한다. 그러나 몇몇 실수도 일어나고, 몇몇 글자들이 첨가된다.

3) 이 새로운 문장이 의미가 있는지를 검사한다.

4) 만약 새로운 문장이 의미가 있다면, 그것이 원래의 문장을 대체한다.

5) 다음 문장을 만드는 단계로 넘어간다.

(이러한 문장들이 모여 4,000 권의 책이 완성된다)

수년동안 진화론자들은 'junk DNA'(쓰레기 DNA, 목적이 없는 DNA로 추정하는)와 같은 DNA의 코드화되지 않은 부분에 주목했다. 지금 우리는 이 'junk' 가 유전자 스위치의 온, 오프를 결정하는 것과 같은 결정적인 기능을 수행함을 알게 되었다. 'junk DNA' 라는 용어는 과거의 무지를 나타내고 있다.한 생물체의 효소들(enzymes)을 (우연히) 만들기 위해서는 1040,000 의 시도가 요구될 것이다. (1040,000 의 크기는, 눈에 보이는 우주는 1080 보다 적은 원자들로 구성되어 있다는 것으로 알 수 있다.)   

 

References and Notes

1. Carl Sagan showed, using straight-forward calculations, why one cell’s worth of genetic information is the equivalent of 4,000 books of printed information. Each of Sagan’s 4,000 books had 500 pages with 300 words per page. [See Carl Sagan, The Dragons of Eden (New York: Random House, 1977), p. 25.]

Each book would have a volume of about 50 cubic inches. An adult human’s body contains about 1014 cells. Somewhat less than 1,000 cubic miles have been eroded from the Grand Canyon. Therefore, we can say that if every cell in one person’s body were reduced to its 4,000 books, it would fill the Grand Canyon 78 times

The Moon is 240,000 miles from Earth. If the DNA in a human cell were stretched out and connected, it would be more than 7 feet long. If all this DNA in one person’s body were placed end-to-end, it would extend to the Moon 552,000 times.

The DNA in a human cell weighs 6.4 x 10-12 grams. [See Monroe W. Strickberger, Genetics, 2nd edition (New York: Macmillan Publishing Co., 1976), p. 54.] Probably less than 50 billion people have lived on earth. If so, one copy of the DNA of every human who ever lived - enough to define the physical characteristics of all those people in excruciating and microscopic detail - would weigh only

less than the weight of one aspirin.

2.'Biochemical systems are exceedingly complex, so much so that the chance of their being formed through random shufflings of simple organic molecules is exceedingly minute, to a point indeed where it is insensibly different from zero.” Hoyle and Wickramasinghe, p. 3.

'No matter how large the environment one considers, life cannot have had a random beginning. Troops of monkeys thundering away at random on typewriters could not produce the works of Shakespeare, for the practical reason that the whole observable universe is not large enough to contain the necessary monkey hordes, the necessary typewriters, and certainly the waste paper baskets required for the deposition of wrong attempts. The same is true for living material.”  Ibid., p. 148.

'From the beginning of this book we have emphasized the enormous information content of even the simplest living systems. The information cannot in our view be generated by what are often called ‘natural’ processes, as for instance through meteorological and chemical processes occurring at the surface of a lifeless planet. As well as a suitable physical and chemical environment, a large initial store of information was also needed. We have argued that the requisite information came from an ‘intelligence’, the beckoning spectre.”  Ibid., p. 150.

'Once we see, however, that the probability of life originating at random is so utterly minuscule as to make the random concept absurd, it becomes sensible to think that the favourable properties of physics on which life depends are in every respect deliberate.”  Ibid., p. 141.

Hoyle and Wickramasinghe go on to say that our own intelligences must reflect some sort of vastly superior intelligence, 'even to the extreme idealized limit of God.” They believe life was created by some intelligence somewhere in outer space and later was transported to Earth. [emphasis in original]  Ibid., p. 144.

*'All point mutations that have been studied on the molecular level turn out to reduce the genetic information and not to increase it.” Lee Spetner, Not by Chance (Brooklyn, New York: The Judaica Press, Inc., 1996), p. 138.

3. Murray Eden, as reported in 'Heresy in the Halls of Biology: Mathematicians Question Darwinism,” Scientific Research, November 1967, p. 64.

*'It is our contention that if ‘random’ is given a serious and crucial interpretation from a probabilistic point of view, the randomness postulate is highly implausible and that an adequate scientific theory of evolution must await the discovery and elucidation of new natural laws?physical, physico-chemical, and biological.” Murray Eden, 'Inadequacies of Neo-Darwinian Evolution as a Scientific Theory,” Mathematical Challenges to the Neo-Darwinian Interpretation of Evolution, editors Paul S. Moorhead and Martin M. Kaplan, June 1967, p. 109.

4.'But scientists have discovered many riches hidden in the junk, and as the [genome] project nears completion, several researchers predict that some of the most intriguing discoveries may come from areas once written off as genetic wastelands. Included among the noncoding DNA, for example, are the crucial promoter sequences, which control when a gene is turned on or off. ... The term ‘junk DNA’ is a reflection of our ignorance.”  Gretchen Vogel, 'Why Sequence the Junk?” Science, Vol. 291, 16 February 2001, p. 1184.

5.'The trouble is that there are about two thousand enzymes, and the chance of obtaining them all in a random trial is only one part in (1020)2,000 = 1040,000 an outrageously small probability that could not be faced even if the whole universe consisted of organic soup. If one is not prejudiced either by social beliefs or by a scientific training into the conviction that life originated on the Earth [by chance or natural processes], this simple calculation wipes the idea entirely out of court.”  Hoyle and Wickramasinghe, p. 24.

'Any theory with a probability of being correct that is larger than one part in 1040,000must be judged superior to random shuffling [of evolution]. The theory that life was assembled by an intelligence has, we believe, a probability vastly higher than one part in 1040,000 of being the correct explanation of the many curious facts discussed in preceding chapters. Indeed, such a theory is so obvious that one wonders why it is not widely accepted as being self-evident. The reasons are psychological rather than scientific.”  Ibid., p. 130.

After explaining the above to a scientific symposium, Hoyle said that evolution was comparable with the chance that 'a tornado sweeping through a junk-yard might assemble a Boeing 747 from the materials therein.” Fred Hoyle, 'Hoyle on Evolution,” Nature, Vol. 294, 12 November 1981, p. 105.



번역 - 미디어위원회

링크 - http://www.creationscience.com/

출처 - CSC

구분 - 3

옛 주소 - http://www.kacr.or.kr/library/itemview.asp?no=589

참고 : 3358|4315|3745|3210|4023|3075|4020|4005|3747|3373|2185|3769|5900|5831|5836

미디어위원회
2004-04-27

항공산업에서 폭격수 딱정벌레를 연구한다.

 (Aircraft Industry Looks to the Bombardier Beetle)


      환원불가능한 복잡한 구조가 자연선택에 의해서 일어날 수 없음을  (예로 ‘Incredible Creatures that Defy Evolution’ 을 보라[1]) 설명할 때  많은 창조론자들이 자주 사용하는 인기있는 폭격수 딱정벌레(bombardier beetle)가 항공 산업에서 철저하게 연구되고 있다고 EurekAlert 가 보고하였다[2].


리즈(Leeds) 대학에서 실시되는 3년 프로젝트는, 매우 온도가 낮은 고공에서 엔진을 점화할 수 있는 방법에 대한 아이디어를 얻기 위해 항공기 설계자들이 곤충을 연구할 것이라는 것이다. 열역학 교수인 매킨토시(Andy McIntosh)는 다음과 같이 설명하고 있다.

 “폭격수 딱정벌레의 방어 메커니즘은 연소(combustion)에 대한 매우 효과적인 자연적 형태를 나타내고 있다. 그러한 자연 메커니즘을 복사(copying)하는 것은, 이미 자연에 존재하는 복잡한 설계(intricate design)의 모습 속에서 많은 것을 배우며 발전하고 있는 생물모방(biomimetic) 분야의 한 부분이다. 이 딱정벌레를 더 잘 이해하는 것은 연소 분야의 연구에 중요한 발전이 될 수 있다.“


 

그래도 이 글에서 “복잡한 설계”가 진화에 의해서 생겨났다고는 하지 않았다. 침묵은 금이다. 말하지 않는 것만 해도 발전되었다.  



1) http://explorationfilmscom.readyhosting.com/folders.asp?action=display&record=13

2) http://www.eurekalert.org/pub_releases/2003-12/eaps-bcp120803.php



번역 - 미디어위원회

링크 - http://www.creationsafaris.com/crev1203.htm ,

출처 - CEH, 2003.12. 8

구분 - 2

옛 주소 - http://www.kacr.or.kr/library/itemview.asp?no=1470

참고 :

Marvin Lubenow
2004-04-27

아프리카 이브가 깨문 애플(컴퓨터)

(The Apple (Computer) Bites The African Eve)


      1987 년에 제안된 'Out of Africa (아프리카를 떠나)', ”African Eve (아프리카 이브)', 'Mitochondrial Eve (미토콘드리아 이브)' 이론은 대중들의 상상을 사로잡았다. 잡지의 표지에는 우리 모두의 어머니라는 설명의 그림과 함께 약 20만년 전에 살았을 것이라는 기사가 실려 있었다. 현대 인류의 기원을 다룬 이론으로(모든 인류의 기원이 아니라), 생화학자 알랜 윌슨(University of California, Berkeley)이 예전 Eve 이론에 약간을 덧붙인 것이었다. 그러나 역사적인 실수는 그녀의 명성을 실제로 강화시키게 될지도 모른다.

이 이론은 논란의 여지가 매우 많지만, 생화학이라는 학문이 인류의 기원을 이해하는데 중요한 도구로서 작용했다는 것이다. 현재 그 결과는 통계적으로 쓸모 없게 된 연구로 보인다. 더욱 새로운 연구가 현대 인류의 기원이 아프리카라는 것을 배제할 수는 없겠지만, 고대 세계의 다른 부분보다 아프리카가 선호될 수는 없다. 사용되었던 방법도 최초 인류의 지리적인 위치나 시기를 결정할 수는 없는 것으로 보인다.

이론 자체는 오히려 멋지다고 생각된다. 이 이론은 에너지를 생성해내는 구조물인 미토콘드리아의 DNA를 다루고 있고, 이 미토콘드리아는 세포 내에 있지만 핵 바깥에 위치한다. 미토콘드리아의 DNA(mtDNA)는 모계로만 유전된다. 아버지의 미토콘드리아 DNA는 편집실에서 끝이 나고 만다. 그렇기 때문에 세대를 거치면서 남자와 여자의 미토콘드리아 DNA가 섞이는 경우는 없다.

이 이론을 발전시킨 버클리의 생화학자 윌슨, 레베카 캔, 마크 스톤킹은 합리적이긴 하지만 증명되지 않은 몇 가지 가정을 하고 있다. 다음 세대로 전해지면서 섞임이 없이 미토콘드리아에서 일어나는 모든 변화는 돌연변이에 의한 결과라고 가정하는 것이다. 또한 이러한 돌연변이는 일정한 비율로 일어날 것이라는 가정을 하고 있다. 이러한 가정에 기초해서 연구자들은 '분자시계”에 접근한다고 믿었다. 다른 DNA보다 빠른 돌연변이율을 갖는 미토콘드리아 DNA이기 때문에, 보다 매끄러운 시간의 순서를 제공해줄 것으로 선호되었기 때문이었다.

최초의 연구인 1987년의 연구는 전 세계의 다양한 인종 136명의 여성에서 미토콘드리아 DNA를 검사함으로서 진행되었다. 연구 결과는 단일 미토콘드리아 DNA 조상은 약 20만년 전 현존하는 사하라 아프리카(sub-Saharan Africa)에 사는 여성으로 추정하였다. 1991년의 계속된 연구는 이 이론을 확증하는 것처럼 보였다.

불행하게도 첫 번째 이브에게 있었던 것처럼, 이 이론의 이브에게도 유혹하는 뱀(serpent)이 있었다. 연구자들은 컴퓨터 프로그램을 디자인할 때 극도로 절약하는(maximum parsimony) 계통분류를 하도록 프로그램을 디자인하였다. 이것은 돌연변이에 의한 변화의 수를 최소로 하는 계통나무(family tree)를 만들게 하였다. 이것은 돌연변이에 의한 변화의 최소의 수로 만든 계통나무일 것이다. 돌연변이에 의한 변화가 무작위적이고 우연히 일어났을 것에 기초하기보다는, 진화가 가장 직접적이고 효율적인 방식으로 일어났을 것을 가정하는 것에 기초하고 있었다. 그러나 컴퓨터 프로그램은 생화학자가 생각하는 것보다 더 복잡했다. 생화학자들은 입력된 데이터의 순서에 의해 컴퓨터의 결과들이 편향된 결과를 산출한 것에 대해서는 알지 못했다. 여러 대의 컴퓨터의 결과와 다른 방식으로 무작위적인 순서로 입력된 데이터를 통해, 현대 인류의 기원이 다른 대륙보다 아프리카를 지지하지 않는다는 것을 알게 되었다. 또한 애초의 연구 당시 생화학자들이 다른 증거에 대한 그들의 지식에 의해 컴퓨터 데이터를 해석하는데 영향을 받았을 것이라는 제안도 제기되고 있어, 이러한 점들이 그들로 하여금 현대 인류의 기원이 아프리카로 치우치도록 한 것으로 보인다.

Nature 지의 편집자인 헨리 기(Henry Gee)는 미토콘드리아 DNA에 대한 연구 결과를 '쓰레기”로 표현했다. 그는 136개의 미토콘드리아 DNA 염기서열을 포함한 항목들을 고려했을 경우 최대로 적게 표현한 계통나무의 수가 10억 개를 넘어선다고 말했다.1 유전학자 알랜 템플턴(워싱턴 대학)은 초기 인류들 중에서 작은 수준으로 섞인 집단이라도 DNA 염기서열이 충분히 섞였을 수 있기 때문에, 현대 인류의 기원에 대한 질문과 '이브(Eve)'의 출현 시기에 대한 질문은 미토콘드리아 DNA로부터 결론 내릴 수 없다고 주장했다.사이언스 지에 보낸 글에서 펜실베니아 주립대학에 재직중인 연구자 중 한 사람인 마크 스톤킹은 아프리카 이브는 가치가 없다고 이야기했다.3 아프리카가 더 많은 유전적 다양성을 지닌다는 것이 일반적인 인식이지만, 그러한 사실에 대한 중요성은 아직 명확하지 않은 채로 남아있다.

'아프리카 이브” 이론은 인류 기원에 대한 질문에 대한 생화학자들의 두 번째 주요한 시도임을 나타낸다. 그 이전에 버클리의 생화학자 빈센트 사리히(Vincent Sarich)는 침팬지와 인간이 분리된 시기는 분자수준의 연구에 기초했을 때 5~7백만년 전 경에 생겼을 것이라고 발표했었다. 그 시기가 고인류학자들이 화석을 통해 측정한 것보다 훨씬 최근의 일이지만 사리히가 제시한 년대는 거의 보편적으로 받아들여지고 있다.

전에 쓰여졌지만 '아프리카 이브”에 대한 최근의 시도로 출판된 논문에서 윌슨(1991년에 죽음)과 칸(현재 하와이대학 재직)은 인류 기원을 설명하는데 있어서 분자 생물학의 장점을 강조했다. 그들은 ”살아있는 유전자는 반드시 조상을 가져야 하지만 죽은 화석은 후손이 없을 수도 있다”고 이야기한다. 또한 분자수준의 접근은 완전하고 객관적인 특징들과 관계하지만 화석기록은 한결같지 않다고 주장한다.4 그러면서 고인류학자들의 방법은 순환논증으로 가는 경향이 있다고 결론지었다. 사실 그들의 말이 옳다! 창조론자들은 그 사실은 수십년간 지적해왔다.

그러나 윌슨과 칸은 자신들이 계통발생론을 주장할 때, 분자생물학에서의 논리적 오류를 보지 못하고 있다. 분자분류학(molecular taxonomy), 분자유전학 또는 분자고고학과 관련된 새로운 분야로 알려진 그들의 접근 방식 역시 순환논증의 방법을 쓰고 있다. 분자유전학은 우리 모두가 유전학과 과학의 객관성에 대한 신념을 가지고 있다는 것을 숨긴 채, 주관적인 진화론의 가정을 주입 받고 있는 것이다. 이 분야에서 진화론에 대한 헌신은 매우 완벽해서 윌슨과 칸은 ”객관적인 증거는 시작단계에서 특정 진화론 모델에 의해 정의되지 않은 증거”라고 이해한다.5

아프리카 이브의 미토콘드리아에 대한 연구는 분자유전학의 다른 측면에서뿐만 아니라, DNA 염기서열에서의 돌연변이를 다룬다. 아마도 우리는 ”진화론자들은 원래 인간의 DNA 염기서열을 본적이 있는지, 무엇이 돌연변이에 의한 결과인지 변화하지 않은 채로 남은 것인지를 알 수 있는지?” 질문하는 것을 포기할 수도 있다. 명백하게 질문에 답변하기 위해서 원래의, 혹은 고대의 염기서열을 알아야만 한다. 오직 하나님만 모든 것을 아시기 때문에 어떻게 진화론자들이 수백만년 전에 존재했다고 믿는 유전자 염기서열로부터 정보를 얻어내겠는가? 사람들은 침팬지의 DNA를 인류의 안내자로 사용했다.6 다른 말로 하면 침팬지 DNA로부터 인류의 DNA가 진화했음을 증명하는 연구가, 침팬지의 DNA가 인류의 기원이라는 가정에서 시작한다는 것이다. 이것은 강력한 순환논증이 되는 셈이다.

진화론자들이 분자시계로서 사용하기 위해 이들 돌연변이율을 판단하는 것은 필요하다. 핵내에 있는 DNA나 미토콘드리아의 DNA에서 어떻게 그들이 돌연변이를 일으켰는지를 보여줄 수 있는 것은 아무 것도 없기 때문에, 우리는 어떻게 진화론자들이 분자시계를 정했는지 질문해야할지도 모른다. 분자시계 개념의 선구자 중 한 사람인 사리히는 다양한 종에서 돌연변이율을 계산하기 시작했다. 다양한 종들의 진화가 일어나는 분기점은 화석에 근거하여 날짜를 매겼다.7 그리고 나서 그는 침팬지와 인류의 분기점을 정하는데 적용하면서 5~7백만년 전에 갈라져 나온 것이라고 주장하였던 것이다. 사리히의 돌연변이 계산을 사용하여 윌슨과 칸은 미토콘드리아 연구에 적용하였고, 인류와 침팬지 사이의 돌연변이 비율과 미토콘드리아 DNA의 분기점을 비교하였다.8 이러한 방법으로 그들은 아프리카 이브가 20만년 전쯤에 존재했을 것이라는 결론에 이르게 된다. 화석기록을 통해 확립된 진화론의 시대간격 위에 DNA 분자를 통한 연구가 놓이게 된 것이다. 다시 한번 언급하면 순환논증임이 명백하다. DNA 분자를 통해 진화론을 주장하는 증거들은 진화론의 가정과 독립적이지 않으며, 오히려 그들의 시작 지점으로서 화석기록에 대한 진화론적인 해석에 기초하고 있는 것이다.

우리 인간은 복잡한 실험을 개발하고 매우 많은 양의 데이터를 처리할 수 있는 능력이 있다. 우리의 문제는 데이터를 처리할 수 있는 능력이 데이터의 질을 평가하는 능력보다 뛰어나다는데 있다. 컴퓨터는 독립적으로 진실을 생성해내지 못할 뿐 아니라, 데이터를 깨끗하게 여과할 수도 없다. 미토콘드리아에 관한 연구가 현대 인류의 기원을 설명할 수 없다는 데에 현재 생화학자들은 핵 속에 있는 DNA가 그 문제를 풀어줄 것으로 선회하고 있다. 네안데르탈인이나 다른 화석 인류로부터 DNA를 복원할 시도도 있다. 더욱이 분자유전학과 복잡한 컴퓨터 프로그램들은 진화론을 돕는데 한 몫을 하고 있다. 결과들은 실제로는 그렇지 않지만, 진화론과 독립적인 기초에서 시작한 것처럼 광고가 된다. 앞으로 분자적 기법으로 진화론 연구가 물밀 듯이 몰려오게 될 것이 예측된다. 이러한 접근법은 진화론적인 가정을 인식하지 못하는 사람들에게 매우 과학적이라는 느낌을 주기 때문에 확신을 줄 것이다.

크리스토퍼 스트링거(영국 자연사 박물관)와 같은 고인류학자들은 현대 인류의 아프리카 기원문제는 미토콘드리아 연구만으로 의존해서는 안 된다고 주장하고 있다. 화석 또한 고려되어야 한다고 주장한다. 그러나 인간 화석의 증거들을 남김없이 조사한다해도, 현대 인류의 아프리카 기원을 지지할 수는 없다. 사실 모든 인류의 화석이 시간대별로 놓여지게 된다면, 진화론자들의 시대에 맞는 화석까지 고려한다해도, 그 결과는 인류가 영장류로부터 진화하지 않았음을 보여주게 된다.9 인류의 진화에 반대되는 화석증거들은 진화론을 거짓으로 판명되도록 효과적일 만큼 강력하다.

성경은 하나님의 형상대로 지은 사람들을 향한 하나님의 계시이다. 창세기는 그러한 계시의 일부이다. 하나님의 계시는 지나가는 정보 그 이상의 것이다. 성경은 인류가 어떤 방법으로도 알 수 없는 진리를 나누어주고 있다. 아프리카 이브 이론의 실패는 과학적 방법으로 인류의 기원을 믿을만한 증거로 만드는 것이 불가능함을 보여주는 하나의 예에 지나지 않는다. 이것이 바로 하나님께서 창세기를 통해 우리의 기원을 믿을만한 계시로 주신 이유이다.

 


References  

1. Henry Gee, 'Statistical Cloud over African Eden,' Nature, 355 (13 February 1992): 583.

2. Marcia Barinaga, ''African Eve' Backers Beat a Retreat,' Science, 255 (7 February 1992): 687.

3. S. Blair Hedges, Sudhir Kumar, Koichiro Tamura, and Mark Stoneking, 'Human Origins and Analysis of Mitochondrial DNA Sequences,' Science, 255 (7 February 1992): 737-739.

4. Allan C. Wilson and Rebecca L. Cann, 'The Recent African Genesis of Humans,' Scientific American, April 1992: 68.

5. Wilson and Cann, 68. Emphasis added.

6. Marcia Barinaga, 'Choosing a Human Family Tree,' Science, 255 (7 February 1992): 687.

7. Wilson and Cann, 68. Bracketed material added.

8. Wilson and Cann, 72.

9. See Marvin L. Lubenow, Bones of Contention (Grand Rapids: Baker Book House, to be published in December 1992). This work is the most extensive treatment of human fossils to be published as yet by a creationist

* Professor of Biblical Studies and Apologetics at Christian Heritage College

 

*참조 : Genesis correctly predicts Y-Chromosome pattern: Jews and Arabs shown to be descendants of one man!
http://creationontheweb.com/content/view/3805/



번역 - 미디어위원회

링크 - http://www.icr.org/pubs/imp/imp-229.htm ,

출처 - ICR, Impact No. 229, 1992

구분 - 3

옛 주소 - http://www.kacr.or.kr/library/itemview.asp?no=656

참고 :

Todd C. Wood
2004-04-27

인간 유전체 : 창조론자의 견해 

(The Human Genome : A Creationist Overview)


      인간 유전체(genome)의 염기서열을 판독하는 것은 분자생물학에 있어서 달에 사람이 가는 것과 같은 일이다. 인간 유전체 프로젝트는 1985년도에 논의되었고, 공식적으로 1990년 국제 협회로 2005년에 완성되도록 시작되었다. 인간유전체 사업(Human Genome Project)에 참여하기로 한 초기 멤버는 미국, 영국, 프랑스, 일본, 중국, 독일이었다. 최근 Craig Venter의 Celera Corporation 이라는 회사의 노력으로 유전체 판독을 끝내 3년 안에 일반에게 공개하겠다고 언급했다. 2001년 2월 Venter씨는 약속을 지켰고, Celera의 인간 유전체의 염기서열이 Science지에 실리게 되었다.1 공공 자금에 의한 HGP의 염기서열 역시 같은 주에 Nature지에 실리게 되었다.2 이러한 염기서열 지도는 인간 유전자 지도의 전체 중 엉성한 지도여서 빈틈을 메우기 위해 작업이 더 필요하며, 완성되기 전의 염기서열 조각들은 사용가능 하도록 되어있다.


지금쯤이면 몇몇 독자들은 아마 정확히 유전체(Genome)란 무엇인가 라는 질문을 하게될 것이다. 불행하게도 그 질문은 쉽게 답할 수 있는 것은 아니다. 간단한 수준에서 말한다해도 유전체란 한 세포의 전체 DNA를 말한다. DNA는 한 개체의 특성을 암호화한 유전자들을 구성하는 nucleotide(핵산을 이루는 물질)들이 길게 연결된 사슬모양의 화학적 물질이다. 그러므로 유전체는 생명의 청사진(blueprint)이나 책(book)으로 생각될 수 있다. 이러한 맥락에서 유전체는 일차적으로 그 개체 자체의 의미가 있는 것이다. 이러한 생각을 매우 단순화하면 생명체는 DNA의 산물이라고 말할 수도 있다. 하지만 창조론자로서 나는 이런 축소된 개념을 반대한다. 하나님은 창세기 1장에서 완전히 성숙한 상태로 생명을 창조하셨다. 그러므로 유전체는 한 개체의 성숙한 상태를 유지할 수 있게 하는 정보들의 저장고로 볼 수 있을 것이다. 하나님께서 성숙한 것에 중요도를 둔 것에 근거하여 나는 인간의 본질과 기능, 인간 유전체 원래의 내용을 밝히고자 한다.


생명의 근원인 유전자에 대한 매우 축소된 관점들이 많은 유명 서적들에서 발견된다. 대부분의 생물학자들은 이러한 관점의 한계를 쉽게 인지하고 있으며, U.S. Funding Agency는 이미 '게놈 프로젝트 이후 시대(post-genome era)' 에서 유전정보의 적용을 강조하고 있다. 실제로 생물학에서는 이런 청사진은 중요한데, 그 이유는 이러한 청사진은 누군가가 읽어서 그 사용법대로 사용하지 않고서는 불활성이고 무기력한 정보로 저장되어있기 때문이다. 그러므로 유전체는 개체를 결정짓는 것이 아니라, 인간을 암호화하고 조정하는데 중요한 정보 자원이라는 것이다.


인간의 유전체는 상염색체(autosomes)라 불리우는 염색체의 쌍 22 개와 성염색체(sex chromosomes)이라 불리는 두 개의 특별한 성염색체(X, Y)로 이루어져있다. 각 염색체는 DNA 한 조각이며, 인간 염색체는 그 크기가 약 4500만에서 2억7900만 nucleotide 정도 된다.3 전체적으로 보면 완성된 인간 상염색체 중 가장 작은 21번째 염색체는 포도당 한 분자보다 5350만 배 더 크다.4 DNA nucleotide는 4 가지 종류를 갖는데 adenine, cytosine, guanine, thymine이다. 우리의 유전자를 구성하는 것은 정보를 담고있는 이들 nucleotide의 서열이다. 이 서열은 매우 클 수도(large-scale) 있으며, 앞뒤로 연결되어 반복되는 구조를 띄는 이염색질(heterochromatin)일 수도 있으며, 매우 독특하고 복잡한 구조인 euchromatin일 수도 있다. 이염색질 부위는 염색체의 centromere와 telomere에서 발견되고 (centromere는 염색체의 중간부위, telomere는 끝부위를 말한다, 역자주)‘knob’이라 불리는 특별한 구조에서도 발견된다. 유전자는 대부분 실염색질(euchromatin) 부위에서 발견된다. 기술적인 이유로 이염색질(heterochromatin)은 정확한 염기서열을 알기가 매우 어려운 반면, 실염색질(euchromatin)은 상대적으로 염기서열을 알기가 쉽다.


Celera사의 인간 유전체 염기서열은 29억 1천만개의 사람 실염색질(euchromatin)의 염기서열을 갖고 있으며, HGP 염기서열은 26억 9천만개를 보유하고 있다. 인간의 유전체는 지금까지 완성된 다른 생물의 유전체중에서 가장 큰 것이다. 그 다음으로 큰 것은 Drosophila(초파리)인데 1억 2천만개의 실염색질(euchromatin) 염기서열을 갖고 있으며, 인간 유전체 크기의 4%에 불과하다.5 Celera와 HGP의 과학자들은 염색체의 염기서열로 유전적, 물리적 지도를 만들어왔다. 그 결과 물리적 위치와 각 연속되는 DNA 염기서열의 위치는 신뢰성있게 알려지게 되었다. 그러나 인간 유전체의 크기는 쉽게 잘못 해석된다. 어떤 사람은 인간이 파리보다 더 크고 더욱 복잡하기 때문에 파리보다 25배 정도는 더 많은 DNA를 가질 것이라 생각하곤 한다. 불행하게도 유전체 속에서 DNA의 양은 생물학적 복잡성과는 연관성이 없다. 예를 들면, 단핵 섬모충인 Paramecium caudatum은 86억 개의 염기를 가지고 있고, 이는 인간 유전체의 2배에 해당한다. 제일 큰 유전체를 갖는 6700억 개의 염기는 단핵세포인 Amoeba dubia 에서 발견된다. 닭같이 다른 복잡한 다핵세포 생물들은 인간 유전체보다 대체로 작은 유전체 수를 갖는다.6


인간 유전체에서 가장 인상깊은 부분 중 하나는, 그 내용을 실질적으로 알지 못한다는 것이다. 복잡한 실험과 컴퓨터 분석방법을 사용하여 Celera의 과학자들은 26,500개의 인간 유전자(human genes)를 알아냈고, 나머지 13,000개의 위치를 예측하고 있다. HGP는 다른 방법을 이용해 전체 31,778개의 인간 유전자를 예측하고 있다. 두 가지 방법들이 잘 일치하는 것은 인간 유전체가 아마도 3만에서 4만개의 유전자를 갖고 있을 것이라는 점이다. 인간 유전자는 복잡한 구조이기 때문에, 이 시점에서 유전자 수를 정확히 말하기란 가능하지 않다. Celera에 의하면 39,000개 유전자의 nucelotide는 29억1천개 염기중 1.1%밖에 되지 않으며, HGP가 측정하기론 인간의 유전자는 유전자지도의 설계도 초안에서 5% 이하라고 한다. 유전체의 나머지는 유전적 조절부위, 중요한 염색체 형태(centromere, telemere), 단순히 알려지지 않은 많은 DNA로 이루어져있다. 유전체의 35%만이 알려진 반복되는 구조이다.7(이러한 것을 Alu repeats, retroelements라고 한다). 놀랍게도 우리가 이해하고 있는 것은 유전체의 매우 적은 부분이고, 인간 유전체의 광대한 부분은 우리들이 연구해야할 남은 과제라는 것이다. 유전자 서열을 아는 것은 단지 시작에 불과하다.


앞서 언급한 철학적인 이해를 덧붙이자면, 인간 유전체는 창조론자들에게 많은 뜻밖의 사실을 알려주고 있다. 첫째로 다양한 인종들이 과학자들이 기대했던 것보다 더욱 유사하다는 것이다. 알려진 인간 유전자 서열을 비교하는 것은 이미 공용으로 사용이 가능한데, Celera의 과학자들은 인류 유전체가 사람마다 1250개의 nucleotide 마다 1개 정도 밖에 차이가 나지 않다는 것을 발견했다. 이러한 차이는 소위 Single Nucleotide Polymorphisms(SNPs)-단염기 다형성-이라 불리운다. 일부 창조론자들은 확실히 이것이 창세기가 창조를 설명하는 것을 확인해준다고 주장하고 있으며, 이러한 통계는 민족우월주의에 대항하는 자료로 사용될 수 있을 것이다. SNP의 빈도를 통해 내가 발견한 놀라운 사실은 인종이 매우 서로 가깝다는 것이다. 현대의 돌연변이 비율에 관해 우리가 아는 사실과 인간이 갈라져 나온 시간에 기초해서 본다면 과거의 일정한 돌연변이 빈도를 가정했을 때, 인간의 유전체는 약 2배 이상의 다양성을 보유해야 한다. 이러한 점은 창조과학자들에 있어 흥미로운 사실이며, 확실히 홍수 이후 생명체의 다양성의 흥미로운 증거가 된다.


둘째로, 유전자 빈도에서 기대할 수 있듯이 SNPs의 1-4%정도만이 유전자를 암호화한다는 것이다.8, 9 그러므로 창조론자들은 점돌연변이(point mutation)가 생명체에 치명적인 효과를 초래한다는 주장이 기술적으로 맞지 않다는 말에 대해 비판할 수 있을 것이다. 왜냐하면 SNP 돌연변이의 95%가 생명체에 눈에 띌만한 영향을 주지 못하는 유전체의 암호화되지 않는 부분이기 때문이다. 이것은 진화에 있어서 썩 좋은 소식은 아님이 분명하며, SNPs는 생물학적 다양성을 만들어내는 그리 썩 좋은 방법이 아니라는 것이 널리 인식되고 있다. 이제는 염색체의 재배열(chromosomal rearrangements), 유전자 이식(gene transfer), 반복 염기서열(repeat sequences)과 같은 새로운 돌연변이가 신다윈주의의 메커니즘으로 가능한 돌연변이일 것이라는 연구가 진행되고 있다.


셋째로, Celera와 HGP의 과학자들은 Alu 반복 염기서열과 인간의 유전자들간의 위치적인 특징을 지적했다. 염색체상의 유전자의 분포는 Alu 반복 염기서열과 매우 유사하다. 유전자가 위치하는 곳이라면 Alu 반복 염기서열은 그리 멀리 있지 않게 된다. 13개의 다른 생물학적 증거에 의하면 나는 최근에 반복 염기서열과 홍수이후의 생물학적 다양성이 인과적으로 연결되어 있을 것이라는 제안을 했다.10 이러한 이론에 기초해서, 나는 우리가 반복 염기서열과 중요한 생명체의 유전자간의 위치적인 특징을 발견해야한다고 예견했다. 그러므로 인간유전체는 생명체의 다양성에 관한 이론을 확인시켜주는 것이고, 창조물(baramins) 내에서의 변화의 메커니즘의 새로운 시각을 제공해줄지도 모른다.


넷째로, 인간 유전체는 놀랍고 복잡한 내부 구조를 보여준다. Celera와 HGP의 과학자들은 유전체 내의 많은 인간 유전자가 2개 내지는 그 이상으로 중복되어 있는 것을 발견했다. 이러한 결과는 예측되었던 반면에 놀라운 것은 3개 내지는 그 이상의 유전자들의 1077개 큰 덩어리들이 유전체에서 그룹으로 중복되어 있다는 것을 발견한 것이다.11 이렇게 비슷한 유전자들의 덩어리가 각 염색체마다 발견되었고, 비슷한 것들끼리 매우 복잡한 구조를 형성하고 있었다. 유전체 내의 중복된 구조의 존재는 전례없는 것은 아닌데, 적은 규모로 Arabidopsis의 유전체 내에서도 내부의 중복된 구조를 보인다.12 이러한 유전자 덩어리들이 하나님의 창조에 의한 산물인지 유전체의 역사적 변화에 의한 것인지 간에, 비슷한 유전자들간의 네트워크는 확실히 생물학적 창조의 규격화된 특성을 보여준다고 하겠다.


인간 유전체의 염기서열을 밝힌 것은 매우 놀라운 업적이며, 21세기 과학의 시작에 필적할만한 일이다. 인간 게놈 프로젝트(human genome project)는 끝난 것이 아니며, 인간 유전체의 대다수의 비밀들이 아직 발견되지 않고 있다. 이러한 유전체의 염기서열로 우리는 하나님의 창조의 놀라움과 신비로움을 밝혀줄 멋진 발견들이 있을 미래의 시대를 기대해 본다.

 


References

1. Venter, J.C., and 272 others, 'The Sequence of the Human Genome,' Science 291(2001): 1304-1351.

2. International Human Genome Sequencing Consortium, 'Initial Sequencing and Analysis of the Human Genome,' Nature 409(2001): 860-921.

3. International Human Genome Sequencing Consortium, ref. 2.

4. Hattori, M., and 61 others, 'The DNA Sequence of Human Chromosome 21,' Nature 405(2000): 311-319.

5. Adams, M.D., and 194 others, 'The Genome Sequence of Drosophila melanogaster,' Science 287(2000): 2185-2195.

6. Li, W.-H. and D. Graur, Fundamentals of Molecular Evolution (Sunderland, MA: Sinauer Associates, Inc., 1991), p. 209.

7. Venter et al., ref. 1.

8. Venter et al., ref. 1.

9. The International SNP Map Working Group, 'A Map of Human Genome Sequence Variation Containing 1.42 Million Single Nucleotide Polymorphisms,' Nature 409(2001): 928-933.

10. Venter, et al., ref. 1.

11. Wood, T.C., 'The AGEing Process: Rapid Post-Flood Intrabaraminic Diversification Caused by Altruistic Genetic Elements (AGEs),' Origins (2001), submitted.

12. Arabidopsis Genome Initiative, 'Analysis of the Genome Sequence of the Flowering Plant Arabidopsis thaliana,' Nature 408(2000): 796-815.

* Dr. Wood is Assistant Professor at the Center for Origins Research, Bryan College, Tennessee.



번역 - 미디어위원회

링크 - http://www.icr.org/pubs/imp/imp-335.htm ,

출처 - ICR, Impact No. 335, 2001

구분 - 3

옛 주소 - http://www.kacr.or.kr/library/itemview.asp?no=650

참고 : 4315|3745|3210|4023|3075|4020|4005|3747|3373|2185|3358|3769|5454|5474

미디어위원회
2004-03-09

지적 설계 운동의 현황과 적용 

(Recent Trend and Applications of Intelligent Design Movement)

이승엽 


Abstract

본 논문은 최근 미국에서 활발히 논의되고 있는 지적설계운동의 현황을 소개하고 지적설계가 적용되는 분야와 그 결과를 살펴보도록 한다. 창조과학 (과학적 창조론)과 지적설계의 유사성과 근본적인 차이점을 논의하고, 연구 프로그램과 각종 저서 및 논문 그리고 공립학교 교과과정 개편 등 다양한 분야에 적용되는 지적설계운동을 살펴본다. 특별히 본 논문은 지적설계의 이러한 활동 중에서 1997년부터 사회적 운동으로 확대시켜 시도되고 있는 '쇄기 운동”과 최근에 오하이오주와 텍사스주 교육위원회에서 결정된 과학교과 과정 개편을 주목하고, 지적설계운동이 어떠한 역할을 담당하였는지 살펴보도록 한다.  마지막으로 국내의 지적설계 운동의 현황과 향후 전략적인 방향 설정을 논의한다.

 

Key Words

지적설계(Intelligent Design), 쇄기운동(Wedge movement), 창조과학 (Creation Science), 진화론 (Evolution  Theory), 환원불가능한 복잡성 (Irreducible Complexity), 복잡특수정보(Complex Specified Information)

  

I.  서   론


1991년 필립존슨의 '심판대의 다윈”의 저서를 통하여 진화론이 자연주의 철학에 근거하고 현재 학문 및 사회 시스템 속에서 창조론의 논의가 제한 되는 현실을 파악하고 그 대안으로 지적설계 운동이 태동되게 되었다. 그 후 많은 과학자 및 철학자들이 이 운동에 동참하여 다양한 활동을 벌이게 되어 연구 프로그램과 각종 저서 및 논문 그리고 공립학교 교과과정 개편 등 다양한 분야에 적용되게 되었다. 대표적으로 마이클 베히의 '환원 불가능한 복잡성”이나 윌리엄 템스키의 '복잡 특수 정보”등이 연구되면서, 생체 매커니즘이나 정보과학에서 지적 설계임을 입증할 수 있는 과학적인 방법을 제시하게 되었다. 본론에서는 지적설계운동의 역사와 1997년부터 사회적 운동으로 시도되고 있는 '쇄기 운동”, 그리고 오하이오주와 텍사스주 교육위원회에서 결정된 과학교과 과정 개편을 논의하고 지적설계가 어떠한 역할을 담당하였는지를 살펴보도록 한다.

 

II.  지적설계운동의 역사 

 

지적설계운동은 1990년대 초부터 미국에서 급부상하고 있는 창조론에 대한 새로운 접근법이라고 할 수 있다. 미국에서 지적설계운동을 이끌고 있는 사람 중 한 사람인 윌리엄 뎀스키는 이를 다음과 같이 정의하고 있다 [1]. '지적설계운동은 지적인 원인들의 영향을 연구하는 과학의 연구 프로그램이고, 다윈주의와 다윈주의의 자연주의적 유산에 대해 도전하는 지적인 운동이며, 하나님의 역사 하심을 이해하는 한 가지 방법이다.”

 

지적설계운동의 역사를 살펴보기 전에 설계논증과 진화론-창조론 논쟁 역사를 간단하게 언급하고자 한다. 19세기 초 윌리엄 팔레이(William Paley)는 그의 책 '자연신학(Natural Theology)”에서 다음과 같이 나타내었다 [2]. 우리가 들판에서 시계를 보았다면, 목적에 대한 적합성은 (즉, 그 각 부분들이 시간을 말해주는 데에 대한 적합성은) 그것이 지성의 산물이며 단순히 방향성이 없는 자연적 과정의 결과가 아님을 보증한다. 따라서 유기체에서의 목적에 대한 놀라운 적합성은, 전체 유기체의 수준에서든 여러 기관의 수준에서든 유기체가 지성의 산물임을 증명한다는 설계 같은 논증을 폈다.

 

팔레이의 시대에는 자연의 작품, 특히 생명체가 지적 설계의 산물이라는 관점이 일반적이었다. 그러나 다윈의 진화론이 학계를 석권하게 되어 생명체가 설계되었다는 관점은 폐기처분되었고, 다윈이 제안한 진화 메커니즘 즉, 자연선택/돌연변이가 생명체의 복잡성에 대한 표준적인 설명이 되었다.  진화론은 1859년 다윈의 '종의 기원”의 출간과 함께 시작되었다. '종의 기원”은 영국과 미국에서 동시에 출간되었으나, 초기의 논쟁은 주로 영국에서 발생했다. 이 논쟁은 생물학 분야뿐만 아니라 정치, 경제, 철학 등 사회 각 영역에 걸쳐 다층적으로 이루어 졌다. 영국에서의 논쟁은 대략 지식인들 간의 논쟁이 주류를 이루었으며, 반진화론적 흐름도 있었으나 전체적으로 보아 영국교회는 진화론과 타협 또는 화해를 이루는 방향으로 나아갔다. 반면 미국의 경우는 반진화론적 경향이 우세했으며, 진화론 논쟁은 처음부터 사회적인 논쟁으로 치달았다.

 

1920년대 본격화된 이 논쟁은 지금까지도 계속되고 있으며, 따라서 창조-진화 논쟁사에 있어서 중심무대를 차지하는 것은 미국이라고 할 수 있다. 미국 창조-진화 논쟁은 1960년을 전후로 대략 두 시기로 나눌 수 있다. 1920년대 스코프스 법정 논쟁으로 대표되는 반진화론 운동과 1980년 아칸소 법정논쟁으로 정점을 이룬 창조과학운동이 그것이다.  최근에 일어난 사건으로는 교과서에서 대진화 내용을 삭제하도록 한 1999년 캔사스주의 교육위원회의 결정을 들 수 있다. 그러나 진화론 지지자들의 압력에 못이겨 그 다음 해 예전의 진화론 교육으로 환원되었다. 2002년 오하이오주와 2003년 텍사스주의 생물학 교과서 개편도 유사한 사건인데 여기에는 지적설계 단체가 결정적인 역할을 담당하였다 [3]. 

 

1990년대 초 등장한 지적설계운동은 최근 미국 창조-진화논쟁을 새로운 방향으로 이끌고 있다. 지적설계운동의 효시는  UC 버클리의 법학 교수인 필립 존슨이 1991년에 출판한 '심판대 위의 다윈(Darwin on Trial)”이라 볼 수 있다 [4]. 이 책에서 존슨은 진화론이 과학적인 근거에 기초한 것이 아니라 자연주의 철학에 근거한다는 것을 보여 주었다. 물론 진화론이 자연주의와 긴밀하게 연결되어 있다는 사실은 존슨이 처음 지적한 것은 아니었다. 그러나 저명한 법학자였던 존슨의 책은 수없이 많이 팔렸고, 그에 따라 많은 지식인들이 존슨이 제기한 문제를 인식하게 되었다.

 

저명한 법학자인 존슨은 다윈 이후 150년 이상 지속되어 온 '창조-진화' 논쟁의 본질이 과학적인 증거로서 해결될 수 있는 문제가 아니라, 무신론 대 유신론이라는 두 개의 상충되는 세계관 사이의 대결이라고 결론 내리게 되었다. 더 나아가 두 개의 상충되는 세계관들이 서로 동등한 입장에 있는 것이 아니라, 일반 학문, 공공 교육, 대중매체 등에서 무신론적인 세계관이 압도적으로 유리한 입장에서 유신론적 세계관을 억누르고 있다는 사실을 발견하게 된다. 그래서 그는 이러한 자연주의의 부당한 우세에 도전장을 내밀게 된다.  학문과 문화에서의 자연주의의 독점을 해체시킨다는 것으로 목표를 정한 후 존슨은 이후 '균형잡힌 이성(Reason in the Balance)' (1995), '다윈주의 허물기(Defeating Darwinism)' (1997), Wedge of Truth (2000), The Right Questions (2002) 등의 책을 지속적으로 출판하면서 보다 많은 사람들이 다윈주의, 더 나아가 자연주의 철학 및 학문의 통나무를 지적설계라는 '쇄기” (wedge)로 허무는 운동에 동참하도록 독려하였다.

 

1996년에는 지적설계운동에 있어서 중요한 전기가 된 큰 사건들이 두 가지가 일어난다. 첫 번째 사건은 Mere Creation이라는 학술대회이다. 구체적으로 어떤 창조론을 지지하든 상관없이 순수하게 '창조'에 대해서만 언급하는 것에 대해 관심이 있는 모든 사람들을 연합시키고자 하였다.  이 학술대회에서는 지적설계에 관심이 있는 200여명의 과학자, 철학자, 그리고 일반인들이 모였는데, 학술대회 결과 지적설계라는 창조론 운동의 새로운 패러다임의 윤곽이 확실하게 드러나게 되었다. 여기에서 철학 및 수학 박사인 윌리엄 뎀스키는 스티븐 메이어, 폴 넬슨 등과 함께 '설명을 찾아 내는 여과기'(explanatory filter)라는 개념을 사용해서 지적설계를 과학의 연구 프로그램으로 만들자고 제안한다. 1996년에 일어난 두 번째 중요한 사건은 미국 리하이(Lehigh) 대학의 생화학 교수인 마이클 베히 박사가 '다윈의 블랙 박스” (Darwin's Black Box)를 출판한 것이다 [5]. 이 책에서 베히는 생화학 시스템 중에는 '환원 불가능한 복잡성' (irreducible complexity)의 성질을 갖고 있는 시스템들이 많이 있고, 이런 시스템들은 설계에 대한 증거로 볼 수 있다고 주장했다. 이 책을 통해서 처음으로 설계를 접목시킨 생물학 연구 프로그램의 구체적인 모습이 드러나게 되었다. 베히의 책은 의 뉴욕타임즈 등 신문, 잡비 뿐 아니라 Science나 Nature 등 전문 학술지에서 비평되었고, Christianity Today에서는 '올해의 책'으로 선정되기도 하였다.

 

그 후 1998년에는 윌리엄 뎀스키가 'The Design Inference”(1998)과 Intelligent Design (1999)를 출간하면서 과학적 연구 활동에 적합한 '설계”의 개념을 정보 이론을 사용하여 정밀하게 검증할 수 있는 기준을 제시하였다. 윌리엄 뎀스키는 지적 원인이 경험적으로 탐지가능하며, 관찰한 데이터에 기반하여 지적 원인과 방향성이 없는 자연적 원인을 믿을 만하게 구분할 수 있는 방법이 존재하며, 여러 특정 과학에서 이미 이런 구분을 끌어내기 위한 방법들이 법의학, 암호학, 고고학, 그리고 외계지성탐사(SETI) 분야에서 다루어지고 있음을 보였다. 베히의 책을 통해서 나타난 생물학 시스템의 환원불가능한 복잡성이 윌리엄 뎀스키의 '복잡 특수 정보(complex specified information)” 이론으로 구체화되어 과학적 연구 프로그램으로서 가능성을 열게 해주었다. 지적 원인의 경험적 탐지가능성은 지적 설계를 전적으로 과학 이론이 되게 하였고 그것을 철학자들의 설계논증이나 전통적으로 '자연신학' 이라고 불리워진 것과 구별되게 하였다.

  

III. 창조과학과 지적설계


미국 자유주의 시민연맹(American Civil Lierties Union: ACLU), 과학교육연방센터(National Center for Science Eduction) 및 여러 단체들은 지적설계를 창조과학의 변형된  형태로 받아들이고 공격한다. 예를 들면 워싱턴주 벌링턴의 고등학교 생물학 선생님인  Roger DeHart가 지적 설계에 대해서 가르치자 그를 창조론을 가르침으로 법을 여겼다고 제소하였다. 그들은 지적설계를 '법정싸움에서 진 창조과학자들의 연막전술”(a smoke screen for creationists who have lost in the courts) 평가절하한다. 비록 지적설계는 창조과학의 관점과 많은 부분에서 일치하지만, 기본적인 접근법에서 차이가 있다. 이러한 차이는 일반적으로 아칸소 창조 재판으로 알려진 1980년 맥리안 대 아칸소 교육위원회 사건 (McLean v. Arkansas Board of Education)의 지방법원 판결인 아칸소 법령 590조나 DeWolf et al [6]에 잘 정의되어있다. 거기에 따르면 창조과학 (과학적 창조론) 이란 다음의 6가지 사실들을 제시하는 과학적 증거와 관련된 추론으로 정의한다.

(1) 우주와 힘과 생명이 무로부터 갑자기 창조되었다.

(2) 돌연변이와 자연선택은 단 하나의 생명체로부터 모든 종류의 생물들의 발생을 일으키기에는 불충분하다.

(3) 원래 피조되었던 식물들과 동물들 속에서 제한적인 범위의 변화만이 일어난다.

(4) 사람과 원숭이는 그 조상이 다르다.

(5) 지구의 지질학은 전지구적인 홍수를 포함하는 대격변에 의해 설명 되어진다.

(6) 지구의 생물은 비교적 최근에 만들어졌다 (수만년 정도) 


이러한 6가지 창조과학에 대한 기본 전제는 연방 대법원에서 에드워드 대 아퀼라드 사건 (Edwards vs Aguilard)에서 대법원 입장을 공식화하면서 인용하였기 때문에, 미국법 내에서 창조과학에 대한 기본 평가로 생각할 수 있다. 창조과학의 (1)번 주장은 과학적인 탐구영역을 넘어서기 때문에 창조과학이 공립학교 과학교과 과정에 포함되도록 하는데 가장 큰 걸림돌이 된다. 한편 지적설계는 다음과 같은 두 가지 기본적인 가정을 기초로 한다.

(1) 지적인 원인이 존재한다.

(2) 이러한 지적인 원인은 (생물체의 특정화된 복잡성을 관찰함으로) 경험적으로 탐지될 수 있다.


윌리엄 뎀스키는 이 두 가정이 지적설계의 최소한의 요구조건이며, 창조주가 누구인가 또는 창조주의 의도는 다루지 않는다고 말하며, 창조과학의 (1) 조건 뿐만 아니라 과학적 탐구영역인 (5)와 (6) 조건과도 구별된다고 말한다 [1]. 왜냐하면 전 지구적인 홍수와 지질학을 통한 지구의 연대 연구는 지적설계의 핵심인 특정된 복잡성의 고려 없이 진행되기 때문이다. 또한 지적설계의 이러한 두 조건으로 인해 (1) 조건을 만족하지만 (2) 조건을 거부하는 유신론적 진화론을 배제한다. 창조과학과 지적설계의 입장의 차이에 대해서 미국창조과학회 (ICR)의 회장인 존 모리스 박사가 다음과 같이 지적한다 [7].

'최근 이 일에 주요하게 참여한 사역자는 지적 설계 운동입니다. 이 단체에는 저명한 과학자나 철학자가 참여하고 있습니다.  그들은 스스로를 기독교운동이라는 주장을 하지 않지만 단호하게 반-자연주의자임은 확실합니다. 그들은 진화론이 근거하고 있는 종교적인 토대와 잘못된 주장을 폭로하고 있습니다. 여러 측면에서 이들의 이론은 철저하게 비종교적이며, 또 훌륭한 과학교습으로 인해 공립학교 교과과정에 적합합니다. 부가해서 말씀드리면, 미국창조과학회는 지적 설계 운동에 반대하지 않습니다. 다만 우리는 그들의 일부가 아니라는 사실을 밝혀두고자 하는 것입니다. 왜냐하면, 우리들은 공개적으로 기독교인임을 천명하는 과학자들입니다. 우리는 자연주의적 진화론에 반대할 뿐만 아니라, 초자연적인 창조사역을 지지합니다. 그리고 우리는 창조주이신 성경의 하나님과 그의 아들 예수 그리스도를 중보로 하는 인격적인 친교를 옹호합니다. 우리는 지적 설계 단체의 과업을 지지합니다. 그러면서도 그들의 과업은 한계가 있다고 솔직하게 말씀드리고 싶은 것입니다. 비록 어느 누가 자연 속에서 디자인의 증거를 발견한다 해도, 그에게는 여전히 구세주가 필요할 것입니다. 미국창조과학회와 지적설계의 십자군운동 (개혁운동)은 모두 효과적이고도 중요합니다.”

 

이러한 미국창조과학회의 지적설계를 대한 입장이 미국창조과학회에게서 많은 영향을 받은 한국창조과학회에도 적용될 수 있다고 본다. 이와 같이 창조과학과 지적설계는 서로 대립적인 관계가 아닌 '하나님의 창조”와 '반진화론”에 관한 일치된 의견을 갖고 상호보완적인 관계라 할 수 있다. 창조과학이 신앙적인 관점과 대중적인 운동이라 한다면, 지적설계운동은 신앙적인 관점을 제거한 지식인과 학문 분야를 겨냥한 유신론 운동이라 표현할 수 있을 것이다. 

 

IV. 지적설계의 적용 - 쇄기 전략

 

지적 설계운동이 반진화론 관점으로 생물학 분야에서만 한정된 것이 아닌 자연주의 세계관에 기초한 모든 학문 분야를 겨냥한 운동으로 확대시키면서 이를 효과적으로 수행하기 위하여 '쇄기”(wedge) 전략을 구사한다. 쇄기 운동을 주도하는 단체는 지적설계를 도입함으로 자연주의 철학에 근거한 학문 및 사회를 변혁하는 정치적인 운동임을 숨기지 않는다.  지적설계의 주요 인물이 참여하는 Discovery Institute가 1996년에 만든 CRSC (Center for Renewal of Science & Curture) -(최근에 Center for Science & Culture로 변경함)에서는 이러한 쇄기운동을 다음과 같은 3단계 과정을 통하여 학문과 문화에 변화를 일으키기 위한 전략을 세웠다 [8]. 이 전략 보고서의 대략적인 내용은 다음과 같다.


1 단계: 과학적인 연구, 저술 및 출판

    - 개인적인 연구 프로그램

    - 고생물학 연구 프로그램

    - 분자생물학 연구 프로그램

2 단계: 대중화 및 매체를 통한 홍보

    - 서적 출판

    - 여론을 형성할 수 있는 학술대회

    - (기독교) 변증 세미나

    - 주요 신문의 특별 기사

    - PBS (미국공영방송) 이나 다른 TV 방송국과 함께 방송 제작

    - 다양한 대중화 저술 및 홍보

3 단계: 문화적인 대립 및 부흥

    - 기존 학문이나 과학에 대항하는 학술대회

    - 교사 훈련을 위한 입법 활동

    - 사회 과학 및 인문과학으로 연구 프로그램 확대


이 쇄기운동에 관한 보고서는 내부적인 백서인데 1999년에 이 내부 보고서가 인터넷에 배포되자 여러 논란이 있었다 [8]. 1999년부터 시작된 쇄기 운동은 현재 1, 2단계 5년 계획(1999-2003)의 마지막 해이다.  이 보고서에서는 그 동안 지적설계 분야에서 이루어진 일과 현재 진행되고 있는 일에 대한 상세한 내용이 포함되어 있다.

 

IV. 지적설계의 적용 - 과학교과서 개편 논쟁

 

아칸소주 창조 재판 (1981)

 1981년에, 아칸소 주의회는 소위 동등시간법으로 알려진  '창조-과학과 진화-과학에 대한 균등한 취급'을 요구하는 590호 법령을 통과시켰다. 이 법령의 시발점은 폴 엘완거(Paul Ellwanger)로서 과학이나 법학에 전문적인 훈련을 받은 적이 없는 사람인데, 나치즘, 인종차별, 낙태 등의 사회 악들이 진화론의 영향에 따른 것이라는 견해를 가지고 있었다. 그는 대략 1997년부터 진화와 창조의 '균형된 취급'을 요구하는 모델 법안을 준비하였다. 지역 복음주의 협회의 도움을 받아  제임스 홀스테드(James L. Holsted) 의원의 동료인 칼 헌트(Carl Hunt)에게 전해주면서 홀스테드 의원이 법안을 상정하게 설득하도록 부탁하였다. 기독교인인 홀스테드는 아칸소 주의회에 법안을 상정하였고, 단지 몇 분의 토의 후에 통과되었다. 이 과정에서 주교육부나 과학자, 과학교육자 등이 조언하거나 증언하지 않았다. 1981년 3월 19일 엘완거의 모델 법안은 거의 수정되지 않은 상태에서 590호 법령으로 제정되었고, 모델 법안의 입법상 '사실 인식'(legislative 'findings of fact')은 590호 법령의 그것과 완전히 동일하였는데, 의회는 어떠한 의미있는 사실 인식 과정(fact-finding process)도 거치지 않았다 [9].

 

스코프스 재판의 진화론 측을 주도했던 미국시민자유연맹(American Civil Liberties Union; ACLU)이 590호 법령이 통과되자마자 이 법령이 헌법에 대한 1차 수정조항의 국교화 금지 조항에 위배된다고 보고 지방 연방 법원에 소를 제기했다.  ACLU는 아칸소 주 내에 있는 법령에 대한 반대자들과 뉴욕의 거대 로펌(law firm)들과 연결되어 원고측으로 재판을 준비하였다. 피고측은 아칸소 주 교육위원회와 위원들, 교육부장관, 주 교과서 및 지도교재 선택 위원회로 구성되었다. 590호 법령의 헌법적 타당성에 대한 소송이 1981년 5월 27일에 접수되었다. 590호 법령의 헌법적 타당성에 의문이 제기된 것은 세 가지 점인데, 먼저 종교의 국교화 금지 조항(Establishment clause)에 위배된다는 것, 둘째로 교사의 학문적 자유를 침해함으로써 1차 수정조항에 나타나는 말의 자유 조항(Free Speech clause)에 위배된다는 것, 그리고 법령의 의미가 불분명하여 14차 수정조항에 나타나는 정당한 절차 조항(Due Process clause)에 위배된다는 것이다. 재판은 12월 7일에 시작되어 12월 17일까지 계속되었다.  ACLU는 이 재판이 스코프스 재판의 속편이나 다름없으며 각종 매체들에 큰 관심을 끌 것이라고 보았으며, 재판에서 가능한 한 주제들을 폭넓게 다루어 매체들을 통해 영향력을 끼치고자 하고 종교, 과학, 교육의 세 가지 영역을 구분하여 전략을 세웠다.  진화론 진영은 이 분야에 명망있는 과학자, 철학자, 교육자등을 동원하여 이 법령의 위헌성 및 창조과학의 종교성 및 비과학성을 입증하도록 노력하였다. 이에 비해 피고측은 전반적으로 잘 조직되지 못하였으며 준비가 부족하였고  어떤 반론이 제시될지 예상하지도 못한 것으로 보인다. 예를 들면 그들은 진화론에 비판적인 과학자 위크라마싱(Wickramasinghe)을 증인으로 불렀으나, 그는 또한 창조론자도 아니었으므로 두 모델 접근법의 문제를 드러내는 격이 되었다. 그 증언은 원고 측(ACLU)보다도 피고 측(아칸소)에 더 큰 피해를 주었고, 판사는 왜 그를 증인으로 불렀는지 의아해 했다.

 

진화론 진영의 전문가 증언 중에서 핵심은 진화론 과학철학자인 마이클 루즈(Michel Ruse)의 증언이다. 왜냐하면 윌리엄 오버톤 (William Overton) 판사의 판결이 마이클 루즈의 창조-과학의 과학성에 관한 증언에 근거하기 때문이다.  루즈는 과학의 필수적인 성질로 다음 다섯 가지를 제시하였다 [10].

 (1) 과학은 자연법칙에 따라야 한다.

(2) 과학은 자연법칙을 바탕으로 해서만 설명되어져야 한다.

(3) 과학은 경험적으로 검증 가능해야만 한다.

(4) 과학의 결론은 일시적인 것이다. 즉, 최종적일 필요가 없고, 따라서

(5) 과학은 반증가능해야 한다


오버튼 판사는 창조과학은 이러한 요건을 충족시키지 못하므로 과학이 아니라고 판정하였다. 그러나 루즈와 오버톤 판사의 이같은 과학에 대한 정의가 많은 과학 철학자들에 의해 비판되었다.  필립 존슨은 '심판대위의 다윈” 9장에서 아칸소 사건을 다루면서 위의 5 가지 과학의 정의 중에서 처음 두 조건이 자연주의와 연결되어 있고 나머지 세 조건은 경험론에 의존해 있으므로 서로 상충되어 있으므로 잘못된 정의임을 보였다 [4]. 


캔사스주 교육위원회 (1999)

 1999년 세계 언론에서는 미국 캔사스주 교육위원회가 6대 4의 투표로 과학교과서에서 생명의 기원을 설명하는 방법으로서 대진화 및 빅뱅 이론을 삭제하도록 하는 결정을 대대적으로 보도했다.  미국에서는 공립학교 교과서 선정에 학부모들이 참가하여 의견을 내 놓을 수 있다. 캔사스주 교육위원회의 결정도 자녀교육을 염려하던 셀티(Celtie) 라는 한 주부의 열정으로부터 시작되었었다. 그러나 교육위원회의 결정 이후 진화론 지지자들의 조직적인 로비와 압력에 못 이겨 2001년에 예전의 진화론 교육으로 환원되었다.


오하이오주 교육위원회 (2002)

 2002년 12월 10일에 오하이오주 교육위원회에서는 18명 전원일치로 일명 'The teach-the controversy” 제안을 오하이오 공립학교에서 과학 교과 표준으로 허락하는 결정을 내렸다. 새로운 법안의 3가지 주요 내용은 다음과 같다 [3].

(1) 생물학적 진화 (대진화-공통조상이론)를 지지하거나 반대하는 모든 증거를 가르친다.

(2) 의무사항은 아니지만 선생님들이 지적설계와 같은 대안 이론에 대해서 토론하는 것을 허용한다.

(3) 자연 현상에 대한 모든 논리적인 설명을 허용할 수 있도록 과학에 대한 정의를 수정한다.


이와 같이 3가지 결정은 그 동안 과학 교과서에서 독점적인 지위를 누려온 진화론을 공립학교에서 공개적으로 비판할 수 있을 뿐만 아니라, 지적 설계라는 용어가 진화론의 대안으로 교과서에 공식적으로 등장할 수 있는 획기적인 전기를 마련하였다. 또한 과학의 정의에 대한 수정안은 자연주의적인 해석만을 강요해왔던 과학의 범위를 확대시킬 수 있게 되었다. 여기에서 과학을 다음과 같이 새롭게 정의하였다. '과학은 관찰, 가정 검증, 측정, 실험 그리고 이론 성립에 근거하여 자연 현상에 대한 적절한 설명을 제시하는 계속적인 연구의 규칙적인 방법이다” (Science is a systematic method of continuing investigation, based on observation, hypothesis testing, measurement, experimentation, and theory building, which leads to more adequate explanations of natural phenomena). 이와 같은 지적설계 진영의 승리 이면에는 10여 년 동안 이루어진 지적설계의 연구 프로그램과 전략적인 쇄기운동이 실효를 거두었기 때문이다. 실제 Discovery  Institute의 Stephen Meyer와 Jonathan Wells 박사가 오하이오주 교육위원회 패널 토의에 참여하였고 교육위원회에 많은 지적설계에 관련된 증빙 자료를 제출하였다. 이 중에는 최근에 유명 학술저널에서 발표된 논문 중 지적설계에 연관된 44 개의 중요 논문을 제출하여 지적설계가 이미 학술적으로 연구 대상이 되고 있음을 보이면서 지적설계는 학술적인 기반이 없음을 비난하는 진화론자들의 의견을 반박하였다 [11]: (본 논문의 첨부란에 여기에서 인용된 44개 논문의 리스트를 첨부함).


텍사스 주 교육위원회 (2003)

텍사스 주 교육위원회 2003년 11월 7일에 2004-2005년에 텍사스주 공립학교에서 사용될 모든 생물 교과서에서 해켈의 배아발생도와 같은 과학적으로 밝혀진 오류를 수정하거나 출판사가 출판 전에 내용상 오류임을 언급하도록 하는 법을 11대 4로 통과시켰다. 이와 같은 결정은 텍사스 주는 미국내에서 캘리포니아 주 다음으로 많은 교과서가 팔리며, 이 교과서가 다른 주에서 사용됨을 고려한다면 이에 대한 파급효과는 크다고 할 수 있다 (캘리포니아, 텍사스, 그리고 플로리다 주 교과서가 미국 전체 교과서 시장의 30%를 점유).  교육위원회 논의 과정에서 오하이오 주 경우와 마찬가지로 지적설계 단체들의 도움이 결정적인 역할을 담당하였다. 다만 처음 주장한 진화론에 반하는 과학적으로 검증된 이론을 포함시키도록 시도하였으나 이 사항은 이번 교육위원회 결정에는 포함되지 않았다.

 


V. 국내 지적설계 운동 및 적용

 

국내 지적설계 운동은 한국창조과학회의 일부 회원들, 특별히 청년모임인 NOAH와 KAIST 창조론 연구회(RACS), 서울대학교 창조과학 연구회(SCR)이 주축이 되어 시작되었다고 할 수 있다. 이 모임들이 주축이 되어 마이클 베히의 '다윈의 블랙박스”, 필립존스의 '위기에 처한 이성” 그리고 윌리엄 뎀스키의 '지적설계”를 번역하여 출간하였다. NOAH는 정기적인 모임을 갖으며 지적설계에 관련된 토론 및 연구를 수행하고 있으며 그 동안 8번의 학술 세미나를 개최하여 지적설계에 대한 다양한 연구를 시도하였다. 초기에는 지적설계에 관련된 자료 소개 및 기본적인 연구에 치우쳤으나 최근에는 지적설계에 관한 창의적인 연구들이 발표되었다 [12].  한국창조과학회에서는 2001년부터 매년 정기적인 학술대회를 개최하고 있는데 2002년 창조과학학술대회에서 이승엽 등이 '지적설계를 적용한 정보저장기기 매커니즘 연구”가 지적설계에 관련된 최초의 연구 논문이라 할 수 있다 [13].

현재 미국에서 지적설계에 관련된 다양한 연구들이 이루어지고 있고 '쇄기” 운동을 통하여 전략적으로 사회 각 분야에 그 영향력을 넓혀가고 있으므로 국내에서도 이와 유사한 지적설계 확대를 위한 구체적인 방향 설정 및 전략이 필요하리라 생각된다.

 

전략적인 관점에서 시급한 것은 국내에서 지적설계운동이 비록 한국창조과학회와 관련되어 연구가 시작되었지만 향후 사회 전반에 걸쳐 그 영향력을 확대시키려고 한다면 '생명체 매커니즘에서 지적인 원인을 경험적으로 탐지 가능”함을 보이는 순수 연구 프로그램을 위한 학술단체의 탄생이 필요하다고 생각된다. 종교적인 관점을 제거한 이러한 학술단체는 자연주의적인 철학에 근거한 진화론 및 학문 분야에 대한 새로운 유신론적 대안을 제시할 수 있을 뿐 아니라 다양한 창조론으로 인해 분리된 기독교 과학자 및 지식인의 연합과 비기독 지식인을 '지적 설계” 안으로 포용하게 됨으로서 반진화론 운동에 효과적으로 대응할 수 있으리라 생각된다.


 

참고문헌 

[1] William Demski, 서울대창조과학연구회 역, 지적설계 (Intelligent Design), IVP, 2002

[2] W. Paley, Natural Theology, 1802. Reprinted in 1972 by St Thomas Press, Houston, Texas

[3] The Ohio Firestorm of 2002, www.sciohio.org/firestorm.htm

J. P. Moreland, ed., The Creation Hypothesis, IVP, 1993

[4] Phillip E. Johnson, 이수현 역, 심판대 위의 다윈, 과학과 예술, 1993,

[5] Michael J. Behe, 김창환 외 역, 다윈의 블랙박스, 풀빛, 2001

[6] David K. DeWolf, S. C. Meyer and M. E. DeForrest, Tehaching the Orgins Controversy: Science, or Religion, or Sppech?, Utah Law Review 39(1), 1994

[7] John. D. Morris, Cracks are Widening in Evolution's Dam,

http://www.icr.org/pubs/president/prz-0205.htm

[8] The Center for Renewal of Science and Curture, The Wedge Strategy,

- www.public.asu. edu/jilynch/idt.wedge.html1997

[9] 김창환, 아칸소 재판, 제 6회 노아학술모임 자료집, http://noah.creation.net,  2002

[10] Michael Ruse, 'But, Is It Science?. Witness Testimony Sheet; McLean v. Arkansas,” Prometheus Books, 1996

[11] Discouvery Institude's Center for Science & Culture, Bibliography of Supplementary Resources for Ohio Science Instruction, - www.discovery.org/csc/ , 2002 (부록 참조)

[12] http://noah.creation.net

[13] 이승엽, 임효석, 지적설계를 적용한 정보저장기기 매커니즘 연구, 2002 창조과학학술대회 논문집

[14] Phillip E. Johnson, 양성만 역, 위기에 처한 이성, IVP, 2000

[13] Phillip E. Johnson, 과기원창조론연구회 역, 다윈주의 허물기, IVP, 2002

[14] Jonathan Wells, Icons of Evolution, IVP, 2000

[15] http://www.leaderu.com/orgs/fte/darwinism

 

 참고문헌 

1. Ying Cao, Axel Janke, Peter J. Waddell, Michael Westerman, Osamu Takenaka, Shigenori Murata, Norihiro Okada, Svante Pääbo, and Masami Hasegawa, 'Conflict Among Individual Mitochondrial Proteins in Resolving the Phylogeny of Eutherian Orders,” Journal of Molecular Evolution 47 (1998): 307-322.

2. Simon Conway Morris, 'Evolution: Bringing Molecules into the Fold,” Cell 100 (2000):1-11.

5. W. Ford Doolittle, 'Uprooting the Tree of Life,” Scientific American, February 2000, pp. 90-95.

6. W. Ford Doolittle, 'Phylogenetic Classification and the Universal Tree,” Science 284 (1999):2124-2128.

7. W. Ford Doolittle, 'The nature of the universal ancestor and the evolution of the proteome,” Current Opinion in Structural Biology 10 (2000):355-358.

8. Douglas H. Erwin, 'Early introduction of major morphological innovations,” Acta Palaeontologica Polonica 38 (1994): 281-294

9. Trisha Gura, 'Bones, molecules...or both?” Nature 406 (2000):230-233

10. Michael S. Y. Lee, 'Molecular Clock Calibrations and Metazoan Divergence Dates,” Journal of Molecular Evolution 49 (1999): 385-391

11. Michael S. Y. Lee, 'Molecular phylogenies become functional,” Trends in Ecology and Evolution 14 (1999): 177-178.

12. Detlef D. Leipe, L. Aravind, and Eugene V. Koonin, 'Did DNA replication evolve twice independently?” Nucleic Acids Research 27 (1999): 3389-3401.

13. Peter J. Lockhart and Sydney A. Cameron, 'Trees for bees,” Trends in Ecology and Evolution 16 (2001): 84-88.

14. David P. Mindell, Michael D. Sorenson, and Derek E. Dimcheff, 'Multiple independent origins of mitchondrial gene order in birds,” Proceedings of the National Academy of Sciences USA 95 (1998): 10693-10697.

15. Paul Morris and Emily Cobabe, 'Cuvier meets Watson and Crick: the utility of molecules as classical homologies,” Biological Journal of the Linnean Society 44 (1991): 307-324.

16. Arcady R. Mushegian, James R. Garey, Jason Martin, and Leo X. Liu, 'Large-Scale Taxonomic Profiling of Eukaryotic Model Organisms: A Comparison of Orthologous Proteins Encoded by the Human, Fly, Nematode, and Yeast Genomes,” Genome Research 8 (1998):590-598.

17. Gavin J. P. Naylor and Wesley M. Brown, 'Amphioxus Mitochondrial DNA, Chordate Phylogeny, and the Limits of Inference Based on Comparisons of Sequences,” Systematic Biology 47 (1998): 61-76

18. Colin Patterson, David M. Williams, and Christopher J. Humphries, 'Congruence Between Molecular and Morphological Phylogenies,” Annual Review of Ecology and Systematics 24 (1993): 153-188.

19. Michael K. Richardson et al., 'There is no highly conserved stage in the vertebrates: implications for current theories of evolution and development,” Anatomy and Embryology 196 (1997): 91-106.

20. Kensal E. van Holde, 'Respiratory proteins of invertebrates: Structure, function and evolution,” Zoology: Analysis of Complex Systems 100 (1998): 287-297.

21. Kenneth Weiss, 'We Hold These Truths to Be Self-Evident,” Evolutionary Anthropology10 (2001):199-203.

22. Carl Woese, 'The universal ancestor,” Proceedings of the National Academy of Sciences USA 95 (1998): 6854-6859, Questions of Process

23. Robert L. Carroll, 'Towards a new evolutionary synthesis,” Trends in Ecology and Evolution 15 (2000):27-32.

24. Douglas Erwin, 'Macroevolution is more than repeated rounds of microevolution,” Evolution & Development 2 (2000):78-84.

25. Scott F. Gilbert, Grace A. Loredo, Alla Brukman, and Ann C. Burke, 'Morphogenesis of the turtle shell: the development of a novel structure in tetrapod evolution,” Evolution & Development 3 (2001): 47-58.

26. Olivier Rieppel, 'Turtles as Hopeful Monsters,” BioEssays 23 (2001): 987-991.

27. Scott F. Gilbert, John M. Opitz, and Rudolf A. Raff, 'Resynthesizing Evolutionary and Developmental Biology,” Developmental Biology 173 (1996): 357-372.

28. George L. Gabor Miklos, 'Emergence of organizational complexities during metazoan evolution: perspectives from molecular biology, palaeontology and neo-Darwinism,” Mem. Ass. Australas. Palaeontols. 15 (1993): 7-41.

29. Neil H. Shubin and Charles R. Marshall, 'Fossils, genes, and the origin of novelty,” in Deep Time (2000, The Paleontological Society), pp. 324-340.

30. Keith Stewart Thomson, 'Macroevolution: The Morphological Problem,” American Zoologist 32 (1992): 106-112.

31. Bärbel M.R. Stadler, Peter F. Stadler, Günther P. Wagner, and Walter Fontana, 'The Topology of the Possible: Formal Spaces Underlying Patterns of Evolutionary Change,” Journal of Theoretical Biology 213 (2001):241-274.

32. Günther P. Wagner, 'What is the Promise of Developmental Evolution? Part II: A Causal Explanation of Evolutionary Innovations May Be Impossible,” Journal of Experimental Zoology (Mol Dev Evol) 291 (2001): 305-309. Questions about the Central Issue: the Origin and Nature of Biological Complexity

33. Philip Ball, 'Life’s lessons in design,” Nature 409 (2001): 413-416.

34. Rodney Brooks, 'The relationship between matter and life,” Nature 409 (2001): 409-411.

35. David W. Deamer, 'The First Living Systems: a Bioenergetic Perspective,” Microbiology and Molecular Biology Reviews 61 (1997): 239-261.

36. Michael J. Katz, Templets and the explanation of complex patterns, Cambridge: Cambridge University Press, 1986.

37. Claire M. Fraser et al., 'The Minimal Gene Complement of Mycoplasma genitalium,” Science 270 (1995): 397-403.

38. Clyde A. Hutchison et al., 'Global Transposon Mutagenesis and a Minimal MycoplasmaGenome,” Science 286 (1999): 2165-2169.

39. Eugene V. Koonin, 'How Many Genes Can Make a Cell: The Minimal-Gene-Set Concept,” Annual Review of Genomics and Human Genetics 1 (2000):99-116.

40. Jack Maniloff, 'The minimal cell genome: ‘On being the right size,’” Proceedings of the National Academy of Sciences USA 93 (1996): 1004-1006.

41. Arcady R. Mushegian and Eugene V. Koonin, 'A minimal gene set for cellular life derived by comparison of complete bacterial genomes,” Proceedings of the National Academy of Sciences USA 93 (1996): 10268-10273.

42. Scott N. Peterson and Claire M. Fraser, 'The complexity of simplicity,” Genome Biology2 (2001):1-7.

43. Leslie E. Orgel, 'Self-organizing biochemical cycles,” Proceedings of the National Academy of Sciences 97 (2000): 12503-12507.

44. Eörs Szarthmáry, 'The evolution of replicators,” Philosophical Transactions of the Royal Society of London B 335 (2000): 1669-1676.

최무용
2004-03-02

성경 속의 신기한 과학이야기 - ④


   앞에서도 살펴보았듯이 많은 과학자들이 성경을 통해 영감을 얻고, 전적인 하나님의 말씀을 신뢰함으로 위대한 과학적 발견들을 한 것을 알 수 있었습니다. 그것은 바로 천지를 창조하신 하나님께서 세상의 질서와 법칙 또한 창조하셨기 때문에 비록 과학책은 아니지만 하나님의 영감으로 기록된 성경책에는 세상의 질서와 법칙들이 담겨있을 수밖에 없는 것입니다.


성경을 통해 이러한 세상의 질서와 법칙을 발견하는 일은 과학적인 업적만을 이루는 것이 아닙니다. 한사람의 인생을 변화시키는 매개체가 되기도 하는 것입니다. 단적인 예로 한국의 창조과학회를 태동시킨 과학자들이 바로 그들입니다. 성경과 과학을 별개의 사실로 믿었던 그들이 미국의 창조과학자들의 강연을 듣고 성경을 다시금 재조명하는 가운데 그들의 삶 전체를 하나님 앞에 헌신하는 삶으로 완전히 바뀌었던 것입니다. 오늘 소개해드릴 성경 속에 인물 또한 하나님의 과학적 법칙을 깨닫고 그의 삶이 바뀐 사람입니다. 바로 야곱입니다.


여러분 멘델의 법칙을 아십니까? 멘델이란 사람은 오스트리아의 수도사로서 유전학자였습니다. 그는 1866년에 오늘날 우리가 알고있는 유전의 법칙을 최초로 발견한 사람입니다. 멘델은 보라색의 꽃을 피는 완두와 흰색의 꽃을 피는 완두를 교배하였더니 1세대에선 보라색 꽃만 나오는데 그 이유는 보라색이 우성이고, 흰색이 열성이기 때문에 그렇다는 것을 알았습니다. 그리고 그 다음 세대에서는 보라색 꽃(우성)과 흰색 꽃(열성)의 비율이 3 : 1이 나온다는 사실 또한 알아내었습니다. 즉 부모의 유전인자가 자식에게로 하나씩 물려지고 우성과 열성에 따라 정확하게 분리되어진다는 사실을 알아냈던 것입니다. 이처럼 20세기에 와서야 이해되기 시작한 유전이론이 3450년 전에 기록된 창세기에 언급되어 있다면 믿을 수 있겠 습니까?


발 뒷꿈치를 잡은 자라는 뜻을 가진 야곱은 매사에 자신의 꾀로 살았던 사람입니다. 그러한 그가 장자의 축복을 가로채기 위해 형과 아버지를 속임으로 형의 미움을 받게 되었습니다. 그로 인해 야곱은 형의 보복에 직면하게 되었고, 이를 피하기 위해 고향을 떠나 외삼촌 라반의 집으로 도피하게 됩니다. 그곳에서 야곱은 그동안 살았던 삶의 보상받기라도 하듯 삼촌 라반에게 속임을 당하며 힘들게 양치는 일을 하게 됩니다. 그는 그곳에서 아내를 얻기 위해 14년, 재산을 얻기 위해 6년의 세월을 외삼촌에게 헌신하게 됩니다. 재산을 얻기 위한 6년의 세월은 야곱과 라반의 엄청난 신경전의 세월이기도 했습니다. 외삼촌의 성향을 알았던 야곱은 자신의 삯으로 양과 염소 중에 아롱진 것, 점 있는 것, 검은 것을 달라고 합니다. 일반적으로 양은 흰색이 우성으로 더 많이 나오게 되어있습니다. 외삼촌은 그것도 아까워서 흰양 만을 야곱에게 주어 먹이게 하였습니다. 여기서도 야곱은 자신의 꾀를 내어 실한 양들이 새끼를 밸 때 버드나무와 살구나무 그리고 신풍나무의 푸른 가지의 껍질을 벗겨 얼룩무늬를 만들고 그것을 양들이 교배를 할 때 눈앞에 보이게 함으로 자신의 삯을 많게 하였습니다. 야곱은 자신의 꾀로 인해 자신의 재산이 늘었다고 생각합니다. 그러나 하나님께서는 야곱 자신의 꾀가 아닌 하나님의 축복임을 알게 하려고 라반을 통해 10번이나 약속을 변경하게 됩니다. 물론 라반의 오랜 양치는 노하우를 살려 야곱의 몫이 될 양의 확률이 더 적은 방향으로 했었겠지요. 그러나 그때마다 야곱은 꾀를 내어 자신의 몫을 늘려갔습니다. 야곱은 하나님의 축복을 깨닫지 못하고 자신의 지혜에 탄복했을 것입니다. 그래서 결국 하나님께서는 야곱의 꿈에 하나님의 사자를 통하여 이 사실을 알려주십니다. 꿈에서 야곱은 자신이 치는 양떼가 교배를 할 때 양 떼를 탄 수양이 다 얼룩무늬 있는 것과 점 있는 것, 그리고 아롱진 것임을 보게 됩니다. 즉 눈으로 볼 때는 모두 흰양이었지만 그 속에는 열성의 성질인 점 있는 것, 얼룩무늬 있는 것, 아롱진 것을 가지고 있었고 하나님께서 그 사실을 이용해 열성인자를 많이 나올 수 있도록 하신 것입니다.


이것이 바로 유전의 법칙인 것입니다. 야곱이 꾀를 내어 환경을 바꾸어 주었기 때문에 자신의 삯인 양이 많이 나온 것이 아니라, 하나님께서 유전법칙을 이용하셔서 축복해 주신 것입니다. 야곱은 이 사실을 깨닫고 벧엘의 하나님을 기억하게 됩니다. 그래서 고향으로 돌아갈 결심을 하게 되는 것입니다. 자신의 지혜만을 믿고 살았던 야곱은 이 사건을 통해 하나님을 신뢰하게 됩니다. 바로 하나님께서는 자신이 만드신 유전법칙을 사용하여 하나님의 전적인 축복임을 멋지게 설명하신 것입니다.


이처럼 하나님이 만드신 세계의 이치인 과학적 사실들을 올바로 깨달을 때 창조주 하나님에 대한 온전한 믿음과 나를 향한 그분의 계획을 깨닫고 하나님께 헌신할 수 있게 되는 것입니다.



출처 - 목회자사모신문

구분 - 3

옛 주소 - http://www.kacr.or.kr/library/itemview.asp?no=1806

참고 :


Duane T. Gish
2003-10-09

치료용 단백질들의 생산 (Production Of Therapeutic Proteins)


 1998년 3월 Impact No. 297 글에서 체세포 전달에 의한 클로닝 과정에 대해 논의했다. 그 과정에서 핵이 제거된 난자에 수정란, 태아, 성체 조직에서 유래한 세포의 핵이 주입되었다. 수정란이 적당한 단계로 성장하면, 준비된 암컷의 자궁에 이식되어 만기가 될 때까지 자라게 된다. 이러한 과정을 통해 핵을 제공한 동물과 유전적으로 완전히 동일한 후손이 탄생하는 것이다. 이 글은 수용체에게 유리한 형질을 주기 위해 혹은 꼭 필요한 단백질이 결여된 인간환자에게 투여할 사람의 단백질을 동물이 생산하도록 하기 위해, 유전자를 전달하는 것에 대해 논의할 것이다.

 

유전자 전달에 의한 치료용 단백질 생산

어떤 사람들은 유전적인 결함 때문에 건강에 꼭 필요한 단백질을 생산하지 못한다. 이런 단백질에는 혈우병을 유발하는 여러 혈액응고인자, 당뇨와 관계되는 인슐린, 정상적인 성장을 어렵게 하는 성장호르몬 등이 있다. 이런 것들을 외부에서 투여했을 경우, 병리적 상황을 개선하거나 치료효과를 볼 수 있다. 이런 분야의 초기 연구는 세균에서 먼저 이루어졌다. 어떤 세균은 plasmid 라고 하는 작은 원형 DNA를 갖기도 하는데, 이것은 모든 세균이 다 갖고있는 chromosomal DNA와는 별개의 것이다. Plasmid를 갖는 세균이 이분법을 하거나 세포분열을 하면, 이 plasmid는 자세포에게도 전달된다. 또한 접합 과정을 통해서도 다른 세균에게 plasmid를 전달해 줄 수 있다.

과학자들은 인간의 유전자를 세균에게 넣을 때, 이 plasmid를 이용할 수 있지 않을까 하고 연구해 왔다. 가령, 만약 사람의 인슐린 유전자를 세균의 plasmid에 넣으면 그 세균은 사람의 인슐린을 생산하게 된다. 과학자들은 매우 특이적인 위치를 자르는 ”제한효소(restriction enzymes, or restriction endonucleases)” 라 불리는 효소들을 찾아내고 분리해 왔는데, 현재까지 분리된 것은 100 가지가 넘는다. 먼저 유용한 치료용 단백질을 code(암호화)하는 유전자가 염색체 중 어디에 위치하는지 알아내고, 적당한 제한효소를 사용하여 그 유전자를 잘라서 분리해 낸다. 같은 제한효소로 plasmid도 자르면, 사람 유전자의 잘린 끝부분과 plasmid의 잘린 끝부위가 잘 맞물리게 된다. 이때 ”DNA ligase” 라는 효소가 맞물린 부위를 붙여주면, plasmid에 사람의 유전자가 들어간 원형 DNA가 되는 것이다. 이렇게 사람의 유전자를 포함하는 plasmid를 세균 속으로 다시 넣는다. 사람의 유전자가 삽입된 균을 배양하면 이와 동일한 균들이 대량으로 생산되는데, 이들은 자신의 DNA를 복제하면서 사람의 유전자도 함께 복제한다. 더욱이 이 균들은 가지고 있는 사람 유전자로 사람의 단백질을 만들어낸다. 균 배양액에서 생산된 단백질을 분리·정제하면, 이것이 부족해서 병을 앓는 환자들에게 투여할 수 있게 된다.


 

Insertion of a DNA section into a plasmid

유전공학을 이용하기 전, 이런 단백질들은 조직이나 혈액에서 힘들게 분리해야만 했다. 그러나 이런 조직에는 매우 소량 존재하므로, 필요한 만큼의 단백질을 얻기 위해서는 원재료가 많이 필요했다. 따라서 이런 단백질의 가격은 매우 비쌀 수밖에 없었다. 유전적으로 변형된 세균의 배양을 통해 상대적으로 훨씬 많은 양을 얻을 수 있게 되었지만, 가격은 (좀더 저렴하긴 했지만) 여전히 비쌌다. 사람의 유전자가 들어간 세균을 다량으로 배양하는 기계인 bioreactor 자체가 매우 비싸고, 과학자나 기술보조원들만이 작동시킬 수 있기 때문이다. 게다가 bioreactor는 온도나 배양액 조성의 작은 변화에도 매우 민감하다.

다행스럽게도 훨씬 저렴하고 효율적인 대안이 발달되어 왔다. 이것은 돼지와 같은 동물을 bioreactor로 이용하는 것이다. 과학자들이 bioreactor를 설계하고 만들고 발전시키는데, 또 사람이 만든 bioreactor를 작동시키는데만 해도 몇 년이 걸렸다. 그러나 하나님은 훨씬 효율적이고 경제적인 bioreactor를 이미 만들어 놓으셨다. 과학자들은 마침내 사람에게 필요한 단백질을, 유전적 변형(조작)을 통해 돼지나 소 등 다른 동물의 젖으로 나오게 할 수 있음을 깨달았다.

Genetic engineering of a milk protein

이제 이러한 작업은 소나 돼지에서 매우 성공적으로 이루어지고 있다. 동물 중에서도 돼지는 많은 장점을 지닌다. 돼지의 임신기간은 겨우 4달이다. 태어난 지 12개월이 되면 돼지는 임신이 가능하고, 한번에 새끼도 많이 낳는데 보통 10∼12 마리를 낳는다. 수유하는 돼지는 일 년에 300L의 젖을 생산할 수 있다. 이런 작업은 다름과 같이 이루어진다.

1. 필요한 사람의 단백질을 암호화하는 DNA 조각(유전자)을 분리한다.

2. 유선에서 단백질 생산을 촉진하는 DNA 조각을 분리하고 위의 조각과 연결한다.

3. 돼지로부터 수정란을 얻는다.

4. 얇은 마이크로 피펫을 이용하여, 난자에 있는 수컷의 생식핵(난자의 DNA와 결합하기 이전의 정자의 DNA) 부위에 사람의 DNA를 주입한다. 그러면 사람의 DNA는 돼지 핵의 DNA 속으로 합쳐지게 된다.

5. 이 수정란은 새로운 태아의 자궁에 착상되어 새끼 암컷 돼지로 성장한다.

6. 일단 암컷 돼지가 성장하면, 그 모유로부터 원하는 단백질을 분리한다.

이 작업은 미국인 과학자에 의해 성공적으로 수행되었고, 1994년 그 결과가 학술지에 발표되었다.1 그들은 혈액응고를 조절하는 Protein C를 암호화하는 사람 유전자를 사용했고, 돼지가 생산한 모유 1L에서 1g의 Protein C를 얻었다. 이것은 사람의 혈장농도의 200배나 되는 수준이다. 여기서 얻어진 Protein C의 약 1/3 만이 생물학적으로 활성이 있었는데, 이것은 단백질이 만들어진 후에도 세포 안에서 많은 변형과정을 거쳐야 하기 때문이었다.

가령, 단백질의 어떤 부위가 잘려지거나, 여러 당들이 단백질의 특정부위에 붙기도 한다. 또 세포벽에 고정되는 부분이 첨가되기도 한다. 과학자들은 'furin' 이라고 하는 중요한 과정을 담당하는 효소를 찾아냈는데, 이것은 매우 소량으로 존재한다. 그래서 앞의 유전자들과 furin 유전자를 결합시켜 본 결과, 활성이 있는 Protein C가 더 많이 생성되었다. 이렇게 얻어진 사람 단백질은 안전성과 효능을 입증하는 시험을 거쳐야 한다. 여기서 소개한 anti-thrombin이라는 항응고 단백질이 현재 임상실험 중에 있다. 이런 과정을 bioreactor 기계의 사용과 비교해 보면, 생화학 기술자들에 의한 생산은 하나님이 만드신 단백질 생산 도구(돼지)에 비교할 수도 없음을 알 수 있다. 유선(乳腺)은, 영양소들의 공급이 잘 이루어지고 분리·정제가 용이하도록 만들어진 단백질을 잘 이동시키는 세포들이 촘촘히 있을 수 있도록, 최적의 상태로 만들어졌다. 이 작업은 성공적으로 입증되었고, 귀한 치료용 단백질을 훨씬 저렴한 가격으로 생산할 수 있는 수단을 제공해주고 있다.

 

1 R.M. Akers, et al., in Recombinant DNA Technology, vol. 2: Special Issue of Annals of the New York Academy of Science, vol. 721, pp. 218-233, May 2, 1994. W.H. Velander, H. Lubon, and W.N. Drohan, Scientific American, January 1997, pp. 70-74.

* Dr. Gish is Vice President of ICR. He has a Ph.D. in biochemistry from the University of California, Berkeley, and worked for many years in research at the Upjohn Company.



Impact No. 299

번역 - 미디어위원회

링크 - http://www.icr.org/pubs/imp/imp-299.htm ,

출처 - ICR, Impact No. 299, 1998

구분 - 3

옛 주소 - http://www.kacr.or.kr/library/itemview.asp?no=673

참고 : 2621|3075|3675|3742|3796|3981|4021|4061|4173|4234|4278|4333|4461|4466|4509|4582|4598|4657|4806|4821|4879|5305|5165|5167|5318|5411

미디어위원회
2003-10-08

하나님이 창조하신 겨울 

- 눈꽃은 우주를 창조하신 하나님의 아름다운 선물

김성현 


     얼마 전 첫눈이 왔다. 한라산에 내린 눈은 나뭇가지를 덮고 새하얀 눈꽃을 피웠다. 이 뜻밖의 장면에 많은 신혼부부들은 마냥 즐거워하는 모습이었다.

눈은 그 자체만으로도 참으로 우리를 행복하게 한다. 온 천지가 눈으로 덮여 있을 때 우리의 마음은 한없이 푸근해지며 세상에 속한 우리의 욕심이 깨끗해짐을 느끼는 것은 하얀 눈이 순결과 무구(無垢)를 상징하기 때문이다. 따라서 우리는 '오라 우리가 서로 변론하자 너희 죄가 주홍 같을지라도 눈과 같이 희어질 것이요…”(이사야 1:18)라는 하나님의 말씀을 잘 이해할 수 있다.

 

생김새가 모두 다른 눈

이런 눈을 자세히 관찰하면 하나님의 놀라운 솜씨를 감상할 수 있다. 현미경으로 혹은 육안으로 빙정(Ice Crystal)의 일종인 눈꽃(Snowflake)을 관찰하면 그 아름다움에 경탄하게 된다. 지구상 60억 명의 사람들이 모두 다르듯이 눈꽃도 하나하나 생김새가 모두 다르다. 많은 경우 육각형을 이루고 있지만 기둥모양, 바늘모양의 눈꽃이 관찰되는 경우도 있다.

천문학자 요하네스 케플러는 최초로 눈꽃을 과학적으로 연구한 사람이다. 그는 결정학의 아버지라고도 불리는데 이는 그가 대칭성에 대해 과학적 연구와 설명을 시도했기 때문이다. 케플러는 비록 내부의 원자배열에 대해서는 명확히 이해하지 못했지만 원자들이 일정한 패턴을 가지고 삼차원적으로 배열되어 여러 가지 모양의 육각형 눈꽃이 생성된다고 생각하였다.

눈꽃은 빙정으로부터 만들어진다. 빙정은 벌집과 같이 육각형 모양을 갖는데 결정학에서는 이를 육방정계 구조라고 한다. 내부적으로는 빙정을 이루는 얼음분자들이 V자 모양의 구조를 가지며 109°의 각도를 이룬다. 각 분자들은 정사면체의 중심에 위치하고 있으며 꼭지점에 있는 4개의 얼음분자들과 수소결합이라고 불리는 결합에 의해 서로 서로 연결되어 있다. 빙정의 육각형을 이루는 면을 기본면(Basal Face), 이와 수직인 면, 즉 기둥부분을 프리즘면(Prism Face)이라고 하는데 우리의 아름다움을 자아내는 면은 주로 기본면이다. 기본면이 프리즘면보다 빨리 성장하면 기다란 육각기둥이나 바늘모양의 눈꽃이 만들어지고 프리즘면이 더 빨리 성장하면 육각판상 모양이나 고사리, 나뭇잎 모양의 눈꽃이 만들어진다. 이때 온도 및 습도에 따라 빙정의 성장 양상이 달라진다.

특히 고사리 모양의 구조는 습도에 영향을 받는데 습도가 높으면 깃털모양이 많이 생성된다. 그러나 아직도 어떤 조건에서 어떤 눈꽃이 형성되는지는 명확히 밝혀져 있지 않다.


눈꽃에 드러난 하나님의 손길

진화론자들은 자연적인 과정에 의해 매우 질서 잡힌 눈꽃이 만들어지는 것을 가지고 이것이 하등생물로부터 고등생물로의 진화를 증거한다고 주장한다. 열역학 제2법칙에 의하면 시간이 경과함에 우주는 점점 더 무질서하게 되어야 하는데 매우 질서정연한 눈꽃이 만들어지는 것으로 보아 진화도 가능하리라는 주장이다. 그러나 이 법칙이 말하고 있는 바는 우주 전체 무질서도의 증가이다. 빙정이 형성될 때 국부적으로 열을 빼앗기기 때문에 빙정 주위의 무질서도는 감소하게 되고 눈꽃이 형성된다. 이 경우 주위의 무질서도는 더 크게 증가하여 전체적으로 우주의 무질서도는 증가한 셈이 된다. 즉 눈꽃의 형성은 열역학 법칙과 어긋나지 않는다.

그러나 진화론자들이 주장하는 진화란 무작위적인 과정이 질서를 이루어 낸다는 것이다. 더구나 그 질서는 더 큰 질서로 계속 무한하게 발전되어 간다고 주장하는데 이는 열역학 법칙에 어긋날 뿐더러 지금까지 한번도 관찰된 적이 없다. 또한 진화의 원동력이라고 생각되어지는 외부로부터의 에너지 유입은 오히려 무질서도를 더 빨리 증가시킨다고 알려져 있다. 이러한 이유로 눈꽃의 형성과 진화는 완전히 다른 과정인 것이다. 눈꽃의 생성은 진화를 증거하기보다는 우주를 창조하신 창조주 하나님의 아름다운 선물이라고 할 것이다.

이러한 과학적인 내용을 모르더라도 우리는 눈꽃의 아름다움을 충분히 즐길 수 있다. 하나님께서 이 가시적인 우주를 창조하셨을 땐 분명히 아름다움을 염두에 두셨으리라 믿는다. 눈꽃에서 발견할 수 있는 다양성과 대칭성은 아름다움과 질서의 하나님을 다시금 생각하게 한다. 또한 계속 탐구할수록 여전히 새로운 사실을 발견하며, 하나님의 무한하신 지혜에 감탄하게 된다.


 "네가 눈 곳간에 들어갔었느냐 우박 창고를 보았느냐” (욥 38:22)


창조지, 제 128호 [2001. 11~12]

송만석
2003-10-08

DNA와 컴퓨터


우리의 자녀들은 초,중,고등 학교에서 진화론 교육을 강요받고 있다.

우리의 자녀들은 우주의 기원, 지구의 기원, 생명의 기원에 관한 이론으로써 진화론만을 배우고 있으며, 진화가 과학적 사실인 것처럼 교육을 받고 있다.  이 세상에 존재하는 모든 것들은 우연히, 그리고 자연적인 과정에 의해서 존재하였고, 인류의 조상은 원숭이 또는 단세포 동물에서 진화되어진 것이라고 배우고 있다.

성경 창세기 1:1절에는 태초에 하나님이 천지를 창조하셨다고 하셨으며, 6일 동안에 우주에 존재하는 모든 것들을 지으셨다고 기록되어 있다.

만일 진화론이 과학적으로 증명된 사실이고 진리라면, 성경은 처음부터 틀린 이야기를 쓰고 있으며, 예수님이 창조주라고 하는 요한복음의 말씀 등 성경의 대부분은 틀린 말씀이 될 수밖에 없다.

오늘 강의에서는 진화론은 하나의 가설에 불과하다는 것과 세상은 우연히 존재할 수 없다는 점들을 과학적으로 밝혀진 사실들을 통하여 설명하고자 한다.

특히 컴퓨터와 유전정보를 예로써 설명하려고 한다.  인류 역사상 가장 위대한 발명품 한 가지를 든다면 컴퓨터가 뽑힐 것이고, 가장 위대한 발견을 든다면 생명체가 유전하는데 필요한 정보인 유전정보라고 할 것이다.  이 두 가지를 비교 설명하면서 생명체의 신비와 초자연적인 지적설계의 산물임을 살펴보고자 한다.

컴퓨터의 내부와 모든 정보는 0과 1로써 표현된다.  컴퓨터간의 정보교환이나 통신수단을 타고 운반되는 모든 정보는 0과 1로써 코드화되어 실행이 되고 있다.
 

생물체도 유전하는데 비슷한 모습으로 이루어지고 있다.

모든 생물체의 기본 단위는 세포라고 한다. 어떤 것은 단일 세포로 되어있어 단세포 동물이라고 하고, 대부분은 식물이나 동물이나 무수히 많은 세포들로 되어있다. 사람은 수십 조 개의 세포들로 형성되어 있다. 각 세포 안에는 핵이 있고, 핵 안에는 유전정보를 담고있는 염색체가 있다. 인간의 체세포에는 염색체의 수가 23쌍이 있다. 이들 안에 DNA라고 하는 유전정보 물질이 들어있는데, 이것을 기호화해서 표현하면 A,T,C,G로 표시되는 염기의 배열로 코드화 되어있다. 게놈 프로젝트는 핵 속에 들어있는 이 암호를 전부 풀어서 쓰는 작업이었다. 지난 10년 동안 10개국 이상의 과학자들이 수퍼 컴퓨터를 사용하여 이 코드들을 aactcttggactaggtcctgaaatgtt처럼 모두 풀어서 지도를 만들었다.

컴퓨터의 모든 것이 0과 1로써 코드화되어 운영이 되는 것처럼, 생명체가 생명이 유지되고 유전이 되도록 하는 모든 정보들은 네 개의 문자로 표시되는 염기 A,T,C,G 들로 코드화 되어있다. 인간의 한 세포안에 들어 있는 코드를 깨알과 같은 작은 글씨로 백과사전 크기의 종이에다 풀어서 썼을 때, 자그만치 그 분량이 85만 페이지나 된다. 이러한 정보가 모든 세포(성세포 제외)마다 꼭 같이 한 세트씩 들어있다.

 

우리의 육체는 이 만한 분량의 정보가 있어야 제대로 태어난다.

우연히 세월이 많이 흐르다 보니 정보가 축적되어 이렇게 되었다고 보는 것이 과학적인 판단인지, 아니면 초자연적인 지적설계의 산물로 보는 것이 과학적인 견해인지 생각해 보아야할 것이다. 게놈 프로젝트를 주도해 온 과학자가 6월에 결과를 발표하면서 자기는 무신론자 였었는데 이 프로젝트를 수행하다가 신을 발견하게 되었고, 그래서 하나님을 믿게되었다고 글을 쓴 것을 보았다.

시편 139편 14절에 말씀하시기를 하나님께서 나를 지으심이 신묘막측하다고 하셨다. 유전정보의 지금까지 밝혀진 내용만 보더라도 그 설계가 너무나 신비하고 놀라울 뿐이며, 이를 통해서 하나님의 말씀을 조금은 더 이해하게 되는 것이다.

우리는 하나님을 믿고 의지하며 동행하면서 믿음이 자라고 하나님을 아는 지식이 자라간다. 우리는 하나님을 본적도 없고 예수님을 본적이 없다. 무언가 보아야 더 잘 이해하고 더 잘 믿게 될텐데, 볼 수 없게 설계해 놓으신 것이다. 그러나 로마서 1장 20절에 보면 하나님의 영원하신 능력과 신성을 만드신 만물 속에서 분명히 보고 알 수 있게 해 놓으셨다고 기록되어 있다. 만드신 만물들을 자세히 살피고 깨달으면서 하나님을 더 이해하고 창조주이신 예수님을 여러 면에서 깨닫게된다. 작품을 열심히 보지도 않고 깨닫지도 못할 때에는, 창조주를 이해하기도 힘들 뿐만 아니라, 창조주의 위대하심을 바른 마음으로 찬양하기란 쉽지 않을 것이다.

요한계시록 4:10절에는 하나님의 보좌 앞에서 24장로들이 하나님을 높이며 찬양드리는 장면이 나온다. 하나님은 영광과 존귀와 능력을 받으시는 것이 합당하다고 찬양을 드리면서 그 이유는 하나님께서 천지를 지으셨기 때문이라고 분명하게 밝히고 있다. 하나님의 위대하심은 창조에 드러나 있으며, 창조주 자신이 친히 피조물인 사람의 형상을 입으시고 십자가에서 형벌을 받으신 것이다. 그리고 주님은 다시 오시겠다고 약속하셨다. 창조주가 없으면 죄가 의미가 없고 십자가도 의미가 없다.  

사탄은 교묘하게도 이 과학시대에 과학의 이름으로 진화론을 교과서에 넣어 가르치게 하는데 성공하였다. 믿지 않은 사람들이 세상이 진화되었다고 받아들이는 것은 물론이고, 믿음이 있었던 학생들도 진화론을 배우면서 성경의 창세기를 신화나 믿음의 차원에서 이해하는 정도에 이르는 경우가 많다.  

우리들은 진화론의 허구적인 사실들을 잘 이해하고 창조의 진리를 확고하게 깨달아야만 하며, 창조신앙을 회복해야할 뿐만 아니라, 진화론으로 세뇌된 사람들에게 창조를 바르게 전함으로써 이 시대에 전도의 문을 열어야한다.



출처 - 창조지, 제 125호 [2001. 5~8]

구분 - 3

옛 주소 - http://www.kacr.or.kr/library/itemview.asp?no=396

참고 :

미디어위원회
2003-10-08

<책소개> 다윈의 블랙박스

김성철

 

「다윈의 블랙 박스」는 1996년에 미국의 생화학자 마이클 베히에 의해 저술되어 2001년 초에 국내에 번역 출판된 근래에 보기 드문 명저이다.
저자인 마이클 베히는 책제목에서도 알 수 있듯이 다윈 시절엔 거의 알려지지 않았던 생화학 분야의 블랙 박스가 이제 드디어 열리게 되었고 이제는 다윈의 진화론으로는 설명할 수 없는 이 분야의 새로운 설명 방식이 도입되어야 한다는 의도를 가지고 이 책을 저술했다.


이 책은 일반인과 전문인을 대상으로 쓴 것으로 생화학에 문외한인 일반인과 전문인이 읽을 부분을 구별하여 저술하였다.

책은 크게 <제1부: 박스가 열렸다>, <제2부: 박스의 내용물들>, 그리고 <제3부: 박스가 우리에게 말해주는 것>으로 구성되어 있는데 독자들은 제2부의 내용을 읽는 데에 상당한 인내를 가져야 할 것이다.

하지만 저자가 그러한 내용들을 의도적으로 제시했던 이유는 '환원 불가능한 복잡성'이라는 설명 열쇠를 제대로 알리기 위해서였다는 것을 명심해 둘 필요가 있다. 베히가 말하는 '환원 불가능한 복잡성'은, '어떤 시스템에서 그 구성 요소의 어느 한 부분이라도 제거되면 사실상 그 시스템의 기능이 모두 정지하게 되는, 더 이상 환원할 수 없는 복잡성'이라는 의미이다. 베히는 쥐덫을 예를 들어 그 개념을 설명한다. 쥐덫은 받침대와 스프링, 해머, 그리고 고정쇠로 구성되어 있다. 이 모든 구성요소가 갖추어져 있어야만 쥐덫은 쥐를 잡는다는 그 기능을 제대로 수행할 수 있다. 해머가 두 개이거나 스프링이 엄청 강하거나 등의 문제와는 별도로 만약에 그 네 가지 구성 요소들 중 하나라도 빠진다면 쥐덫은 그 기능을 전혀 수행할 수 없으므로 위의 네 가지가 다 갖추어진 상태가 쥐덫에게는 환원 불가능한 복잡성의 상태가 되는 것이다. 만일 우리 주위의 생명체가 그러한 특징을 가진다면, 우리는 다윈의 진화론을 근본부터 의심하지 않을 수 없을 것이다. 이 책에선 편모와 섬모의 운동이나 항원 항체 반응, 그리고 세포 내의 운송 시스템 등이 환원 불가능한 복잡성을 가지고 있어서 다윈이 주장했던 점진적인 진화에 의해선 이런 부분을 도저히 설명할 수 없다는 것을 보이고 있다.

 우리가 그 지적설계자가 누구인지 아는 것과는 무관하게 생명체가 지적 존재에 의해 설계되었음을 추론할 수는 있다

 이 책 제3부의 책장을 넘기면 독자들은 상당한 지적 흥분을 경험하게 될 것이다. 베히가 주장하는 내용들이 1990년대부터 새롭게 일어난 지적설계(Intelligent Design) 운동의 맥락에서 다시 한번 정리되고 심화되기 때문이다. 지적설계 운동의 기본 모토는 이렇다. 과학활동을 통해서는 지적설계자가 누구인지 제대로 알 수가 없겠지만 우리가 그 지적설계자가 누구인지 아는 것과는 무관하게 생명체가 지적 존재에 의해 설계되었음을 추론할 수는 있다는 것이다. 이러한 맥락에서 볼 때 생화학 시스템에서 발견할 수 있는 환원 불가능한 복잡성은 지적설계의 아주 좋은 논제가 될 수 있는 것이다.

이 책은 미국에서 출판되자마자 과학계에서 먼저 이슈가 되었고 수많은 반론과 찬반 논쟁을 불러 일으켰다. 과학자들과 일반인들에게 동시에 관심의 대상이 되었던 이 책은 창조론의 새로운 모습을 제대로 제시했다는 점에서 그 의의가 크고 지적설계 운동이 생화학이라는 학문에 접목되어 하나의 연구 프로그램으로서 제시되었다는 점에서 기독교 과학자들뿐만 아니라 일반 과학자들에게도 무척이나 신선한 영감을 주고 있다.

다윈의 진화론이 종국을 맞이하게 되느냐, 아니면 이 난국을 가까스로 극복하게 되느냐의 문제는 21세기의 새로운 창조-진화 논쟁으로 이어지게 될 것이다. 하지만 이 논쟁은 창조론은 종교, 진화론은 과학이라는 구태의연한 논쟁 구도와는 전혀 차원을 달리할 것이 분명하다. 왜냐하면 저자가 강조하듯이 다윈의 '블랙 박스'는 이미 열려 버렸기 때문이다.


출처 - 창조지, 제 125호 [2001. 5~8]



서울특별시 종로구 창경궁로26길 28-3

대표전화 02-419-6465  /  팩스 02-451-0130  /  desk@creation.kr

고유번호 : 219-82-00916             Copyright ⓒ 한국창조과학회

상호명 : (주)창조과학미디어  /  대표자 : 박영민

사업자번호 : 120-87-70892

통신판매업신고 : 제 2021-서울종로-1605 호

주소 : 서울특별시 종로구 창경궁로26길 28-5

대표전화 : 02-419-6484

개인정보책임자 : 김광