

회충의 DNA는 미래를 대비하고 있었다. 

: 장래 일에 대한 계획은 설계를 가리킨다. 

(Roundworm DNA System Plans Ahead)

by Brian Thomas, Ph.D.

     흥미로운 연구 결과로서, 많은 동물들은 때때로 후성유전학(epigenetics, 후생유전학)이라는 과정을 사용하여, 자신들의 환경에 대한 정보를 후손에게 전달할 수 있는 능력을 갖고 있음이 밝혀졌다. 매우 자주, 부모나 조부모의 환경 경험에 대한 유전적 기억은 6세대를 넘지 않는다. 최근 연구자들은 우연히 알려진 것 중에서 가장 멀리까지 도달하는 후성유전학적 신호를 발견했다.[1]

생물들은 후성유전학을 사용할 때, 유전자를 통하지 않고, DNA 가닥에 고정되어 있는, 그리고 유전자 활동의 시기와 강도를 조절하는데 도움이 되는, 다른 분자들의 패턴을 사용하여 전달한다.

스페인의 바르셀로나와 바바로나의 과학자들은 Science(2017. 4. 21) 지에 그들의 놀라운 발견을 발표했다.[1] 그들은 회충(roundworms)의 외부온도 지표가 14세대 후손에게까지 전달되는 것을 관측했다. 그런 다음, 연구팀은 이러한 놀라운 데이터 전달이 어떤 과정으로 이루어지며, 어떤 목적으로 전달되고 있는지를 추정하였다.

연구자들은 회충의 유전체(genome) 내로 전이유전자(transgenes)라고 불리는, 외래 유전물질을 인위적으로 삽입했다. 그후 전이유전자는 정상적으로 유전된 DNA의 일부가 되었다. 이러한 특정 전이유전자는 연구자들이 쉽게 추적할 수 있는 단백질에 대한 암호를 갖고 있었다.

연구 결과가 보여준 것은, 몇몇 회충 세포들은 다른 세포들보다 더 자주 전이유전자에 접근한다는 것이었다. 왜냐하면, 그들의 조상이 저온 환경에서 살았었기 때문이었다. 전이유전자를 포함하여, DNA는 세포 내부의 단백질 스풀(spools, 실패)에 감싸여져 있다. 특정 꼬리표(tags, 태그)들이 스풀에 부착되어 있는데, 차가운 저온 환경에서 살았던 회충은 그러한 꼬리표들을 더 많이 갖고 있었다. 그 꼬리표는 유전자 처리 분자기계들의 도킹(docking) 과정을 방해한다. 이것은 전이유전자에 대한 접근을 제한시킨다.

그것은 마치 어떤 부모가 ”여러 세대 동안 열지 마시오”라는 메모의 꼬리표를 붙여서, 후손들에게 파일을 전달하는 것과 같다. 왜냐하면 그들의 후손은 당분간 파일의 내용물을 필요로 하지 않을 것으로 추정하기 때문이다. 그러나 회충의 경우, DNA 파일은 12세대 이상 밀봉되어 전달되고 있었다. 꼬리표 패턴은 알들을 통해서 다음 세대로, 또 다음 세대로, 온도에 대한 기억을 전달하고 있었다. 그렇다면, 그 이유는 무엇 때문일까?

Science 지의 수석 저자는 설명했다. ”우리는 이런 일이 왜 발생하는지, 정확히 알지는 못하지만, 그것은 생물학적 장래 계획(biological forward-planning)의 한 형태일 수 있다”는 것이다.[2] 미리 예정된 목적이 아니라면, 어떤 통신시스템이 이와 같은 메시지를 보내고 있는 이유는 무엇인가? 

만약 한 생물이 자신의 삶 동안에 견뎌온(따라서 그들의 후손이 견뎌야 할) 온도 범위를 그들의 증손자 증손자 증손자에게 자동적으로 경고할 수 있다면, 후손들의 몸은 온도 변화에 더 잘 적응하도록 준비할 수 있을 것이다.

그러나 장래 일에 대한 준비는 어떻게 생겨날 수 있었을까? 이것도 무작위적인 돌연변이들로 우연히 생겨났는가? 장래 계획은 설계를 의미한다. 진화론의 기초가 되고 있는 자연적 과정은 미래의 가능성을 준비할 수 없다. 그러나 창조주는 하실 수 있다. 창조주께서는 피조물들이 ”생육하고 번성하여.. 충만할 수 있도록” 계획을 세워 놓으셨다. 그분은  그분의 창조물들에 미래의 가능성에 대처할 수 있는 최고의 메커니즘을 내장시켜 놓으셨던 것이다.[3]


1. Klosin, A., et al. 2017. Transgenerational transmission of environmental information in C. elegans. Science. 356 (6335): 320-323.
2. Environmental ‘memories’ passed on for 14 generations. Centre for Genomic Regulation Press Release. Posted on April 20, 2017, accessed April 21, 2017. ScienceDaily, April 20, 2017.
3. Genesis 1:22.

번역 - 미디어위원회

링크 - 

출처 - ICR News, 2017. 5. 15.


엔코드 프로젝트에 뒤이은 4D 뉴클레옴 프로젝트는 

DNA의 슈퍼-초고도 복잡성을 밝혀낼 것이다. 

(The 4D Nucleome Project Helps Creationist Research)

Salvador Cordova 

      미국 국립보건원(National Institutes of Health, NIH)은 수십억 달러의 연구 자금으로 4D 뉴클레옴(4D Nucleome) 프로젝트와 엔코드(ENCODE) 프로젝트를 심도 있게 진행할 계획으로 있다.

헤르만 뮐러(Hermann Muller)는 사람의 돌연변이(human mutations)와 선천적 결손(birth defects)에 대한 연구로 노벨상을 수상했다. 뮐러 이론의 결과는 진화론적 가정 하에서, 사람 유전체(human genome)는 단지 2%만이 기능을 할 수 있다는 것을 의미했다. 따라서 많은 진화론자들은 사람 유전체의 98%가 원칙적으로 정크(junk, 쓰레기)임에 틀림없다고 주장해왔다. 뮐러의 연구는 세계적으로 유명한 유전공학자이며, 진화론을 거부하고 있는, 코넬 대학의 존 샌포드(John Sanford)의 책 ‘유전적 무질서도와 유전체의 신비(Genetic Entropy & The Mystery of the Genome)’에 요약되어 있다.

2012년에 3억 달러의 연구자금이 투입되어 실시됐던, 미국 국립보건원의 엔코드 프로젝트(ENCODE project)에서 약 200명의 연구자들은 사람 유전체의 80%가 기능적이라고 선언했다. 이것은 진화론자들이 2%만이 기능적이라고 말했던 것과는 엄청난 차이를 보여주는 것이었다. 엔코드 프로젝트의 선언은 댄 그라우(Dan Graur)와 같은 진화 생물학자들의 격분을 불러일으켰고, 그는 엔코드 연구자들을 '사기꾼들(crooks)”과 '무식쟁이들(ignoramuses)”이라고 부르면서, '진화론 없는 복음(evolution free gospel)'을 선전하고 있다고 비난했었다. 댄 그라우는 엔코드 연구에 의해서 얻어진 데이터들을 '배설물 더미(piles of excrement)'라고 말했고, 엔코드 프로젝트의 리더 중의 한 사람인 이완 버니(Ewan Birney)를 '과학계의 사담 후세인'이라고 불렀다.

이제 엔코드 프로젝트는 NIH의 3억 달러의 연구자금이 들어가는 RoadmapEpigenomics 프로젝트와, psychENCODE와 같은 다른 프로젝트, 그리고 2억5백만 달러의 E4 Epistranscriptomic 프로젝트와 같은 다른 프로젝트들뿐만 아니라, psychENCODE 및 4D nucleome과 같은 더 작은 프로젝트들을 생겨나도록 했다. 이것에 덧붙여서, 여러 제약회사들은 생물체가 사용하는 일련의 당분자인 글리콤(glycome, 당질체)과 다른 많은 '-omes”들을 탐구하기 위해서, 수십억 달러의 연구비를 투자하고 있다. 

DNA는 단백질에 대한 단순한 청사진(blueprints) 이상을 제공한다.

2014년에 미국 국립보건원은 DNA의 4차원(4-dimensional) 구조를 탐색하기 위한 4D 뉴클레옴(4D Nucleome) 프로젝트를 시작했다. 많은 과학자들에 의해서, 특히 진화 생물학자들에 의해서, DNA는 단백질들에 대한 단순한 청사진으로서만 기능을 한다고 잘못 알려졌었다. 그러나 DNA는 단백질에 대한 단순한 청사진 이상을 제공하고 있었다. DNA는 세포 구조를 관리하고 있는 모든 종류의 분자기계들에 대한 3차원적 주차장(3-dimensional parking lot)으로서 역할을 하고 있었다. 이러한 3차원적 주차타워는 여러 세포들마다 서로 다르게, 심지어 한 세포에서도 여러 세포단계마다 다르게 구축되고, 형태가 바뀌고 있었다. 주차타워의 형태는 시간에 따라 변하고 있었기 때문에, 이것은 지금까지 알지 못했던 DNA의 4차원적 슈퍼-초고도 복잡성을 가리키고 있는 것이었다.

4D 뉴클레옴 프로젝트(4D nucleome project)는 하나님은 정말로 초월적 지혜의 엄청나신 분이시며, 그 분의 경이로운 설계의 극히 작은 일부분을 우리가 보기 시작했다는 것을 알려주고 있다. 지금까지 창조과학자들은 하나님의 피조물들을 연구하고, 진화론의 허구성을 드러낼 연구자금이 부족했었다. 그러나 이제 하나님은 창조과학자들의 편에 서셔서, 엔코드 프로젝트가 옳았고, 진화론이 잘못됐다는 것을 증명하기 위해서, 수십억 달러의 공적자금과 사적자금을 보내주고 계시는 것이다.

번역 - 미디어위원회

링크 - 

출처 - CEH, 2017. 4. 23.


엔코드’ 연구로 밝혀진 유전체의 초고도 복잡성. 

: ‘정크 DNA’ 개념의 완전한 몰락 

(ENCODE Reveals Incredible Genome Complexity and Function)

Jeffrey Tomkins Ph.D

      최근 진화론과 창조론 진영 모두 크게 소동하고 있다. 그것은 사람의 유전체(human genome)는 극도로 복잡하며 지적으로 설계되었음을 선포하고 있는, 30개의 연구 논문들이 동시에 발표되었기 때문이다.[1] 진화론적 관점에서, 이것은 그동안 주장되어 오던 ”정크 DNA(Junk DNA, 쓰레기 DNA)” 신화에 완전히 결정적인 타격이 되고 있었다. 조나단 웰스(Jonathan Well)의 최근 책 ”정크 DNA의 신화(The Myth of Junk DNA)”에서 폭로했던 것처럼, 이 진화론적 개념은 과학적 관점에서 하나의 사기(fraud)였음이 밝혀진 것이다.[2]

대규모 국제적 연구 노력인 ‘엔코드(ENCODE, Encyclopedia of DNA Elements)’는 인간 유전체 프로젝트(Human Genome project)를 확장하여 2003년에 시작되었다. 엔코드의 목표는 전체 인간 유전체의 기능을 지도화 하고 특성화 하는 것이었다.

엔코드 이전의 생물학자들은 단백질 암호 부분인 DNA의 작은 부분만 단지 이해하고 있었다. 따라서 DNA의 대부분은 쓸모가 없다고 생각했었다. 그러나 2007년에 게재됐던 엔코드 연구 결과의 첫 번째 단계에서, 논문의 저자들은 유전체는 골고루 전사되고 있으며, 그 염기쌍들의 대부분은 단백질 비암호 전사체들을 포함하여 일차 전사체에서 발견된다는 확실한 증거를 제공하고 있다'고 보고하였다.[3] 세포에서 전사되는 DNA의 모든 부분들은 어떤 무엇인가로 사용됨에 틀림없었다. 다른 말로해서, DNA의 비암호화 부분은 결국 쓰레기(junk)가 아니었다.   

엔코드의 두 번째 단계는 더욱 장관이었다. 네이쳐(Nature) 지에 발표된 선도적 연구 논문들에서, 저자들은 ”이러한 데이터는 잘 연구된 단백질 암호 영역 외에 있는, 유전체의 80%에 대한 생화학적 기능들을 할당할 수 있게 하고 있다”라고 말했다.[1] 이러한 발견에 반응하여, 엔코드 프로젝트의 수석 과학자 중 한 명인 톰 진저라스(Tom Gingeras)는 말했다. ”거의 모든 뉴클레오타이드 마다 어떤 종류의 기능과 관련되어 있다. 그리고 이제 우리는 그것들이 있는 곳이 어디며, 무엇과 결합하고 있는지, 조합되어 있는 것이 무엇인지 등을 알고 있다.”[4]

그리면 나머지 20%의 유전체는 무엇인가? 그들도 역시 기능을 가지고 있는가? 엔코드의 수석 분석 조정자인 이원 버니(Ewan Birney)에 따르면, 그것 역시 의미없는 정크(junk, 쓰레기)는 아닐 것이라는 것이다. 버니는 인터뷰에서 말했다. ”80%는 곧 100%가 될 것입니다. 불필요한 DNA 부분은 정말로 없습니다. 이제 ‘정크(쓰레기)’라는 비유는 유용하지 않습니다.”[4]

버니는 많은 비평가들이 80% 라는 수치가 어떻게 나온 것이며, 기능적이라는 단어의 정의는 무엇인지에 대해 논란이 있을 것으로 예상했다. 버니는 덧붙였다. ”그 수치는 죽은 나무의 유전체와 살아서 활동하는 나무의 유전체 사이의 차이를 전달하는 것이다.” 그리고 ”어떤 식으로 고려해보든, 우리가 알고 있는 것보다 유전체에서 더 많은 일들이 일어나고 있다는 사실에 익숙해져 가고 있다.”[4]

아마 어떤 사람들은 이러한 엔코드 연구에 참여한 과학자들의 말을 단순히 과장된 것으로 취급하려 할 것이다. 그러나 80% 라는 수치는 Nature 지의 논문 18p에 명확하게 서면으로 기술되어 있다.[1] 또한 이러한 기술은 세계 여러 국제 연구소의 선도적인 수백 명의 유전체 과학자들이 기술한 30편의 엔코드 논문들로부터 온 것이다.

새롭게 발견된 사람 유전체의 경이로움에 관한 이러한 놀라운 보고는 창조론자들이 하고 있는 것이 아니다. 사람 유전체의 경이로운 초고도 복잡성은 우리가 하나님의 형상을 따라 창조주 하나님에 의해서 놀랍도록 경이롭게 창조되었음을 증거하고 있는 것이다.


1. The ENCODE Project Consortium. 2012. An Integrated Encyclopedia of DNA Elements in the Human Genome. Nature. 489 (7414): 57-74.
2. Wells, J. 2011. The Myth of Junk DNA. Seattle, WA: Discovery Institute Press.
3. The ENCODE Project Consortium. 2007. Identification and Analysis of Functional Elements in 1% of the Human Genome by the ENCODE Pilot Project. Nature. 447 (7146): 779-816.
4. Yong, E. ENCODE: the rough guide to the human genome. Discover Magazine. Posted on September 8, 2012.
* Dr. Tomkins is Research Associate at the Institute for Creation Research and received his Ph.D. in Genetics from Clemson University.


*참조 : '스위치 DNA' 400만개가 질병 유발 (2012. 9. 6. 한국일보)

유전자 포함 안 된 ‘쓰레기 DNA’ 알고 보니 질병 관장 (2012. 9. 6. 한겨레)

‘쓰레기 DNA’ 질병과 직접 연관 (2012. 9. 6. 경향신문)

인간의 DNA에 쓸모 없는 부분은 없다 (2012. 9. 7. 동아사이언스)

인간 DNA 백과사전 완성 (2012. 9. 6. 아시아경제)

'정크 DNA’의 퇴장, 생명연구의 확장 (2012. 9. 14. 한겨레)

번역 - 미디어위원회

링크 - 

출처 - ICR News, 2012. 9. 24.


위-위유전자는 진화론 패러다임을 뒤흔들고 있다. 

(Pseudo-Pseudogenes Shake Up Evolutionary Paradigm)

by Jeffrey P. Tomkins Ph.D.

      위유전자(pseudogenes, 유사유전자)는 한때 유전체 화석(genomic fossils, 오래 전에 돌연변이가 일어난 유전자의 파괴된 잔해)으로 여겨졌었다. 그러나 많은 위유전자들이 생명체에서 매우 기능적이며 중요하다는 연구 결과들이 점차 나타나고 있다. 이제 새로이 규명된 한 위유전자는 기능성 단백질을 생산하는 것으로 나타났다. 그러나 그 유전자를 필요로 하는 세포에서만 발견되었다. 연구자들은 이제 위-위유전자(pseudo-pseudogene)라는(가짜가 가짜라는, 즉 진짜라는) 새로운 이름을 붙이고 있었다.[1]

진화론자들은 위유전자를 원래 한때 기능적이었던 유전자의 잔재로 특징지었었다. 이것은 한 기능성 단백질의 생산을 조기에 중단시켰던, 그들의 염기서열 상에서 명백히 '정지신호(stop signals)'에 기초한 것이었다. 그러나 이러한 초기 평가는 지나치게 단순한 견해였으며, 단백질 생산의 복잡성에 대한 고급정보의 결여에 기인한 것이었음이 밝혀졌다.

유전자의 RNA 사본이 만들어질 때, 단백질을 이루는 특정 아미노산들에 대한 3개의 연속적인 염기서열 암호는 코돈(codon)이라 불려진다. 어떤 특정 코돈은 번역(translation)이라 불리는 단백질 생산 과정 동안에 정지신호를 보낸다. 이제 ‘조기종결 코돈(early termination codon, PTC)’이라 불리는, 한 명백한 정지 코돈은 정지의 발생을 의미하지 않는 것으로 밝혀졌다.[2] 이 현상을 ‘정지코돈 초과번역(stop codon readthrough)’이라고 불리며, 한 기능성 단백질을 생산할 수 있다.

정지코돈 초과번역(정지되지 않고 계속 번역됨) 현상은 매우 복잡하며, 다양한 요인들에 의존하고 있다. 여기에는 정지코돈의 특별한 염기서열, 그것이 발생하는 곳의 주변 RNA 염기서열, 번역과정 동안에 다른 자극 인자들의 존재(예로, 단백질 및 RNA) 등이 포함된다.[2]

대부분의 경우, ‘정지코돈 초과번역’의 연구는 단지 박테리아와 바이러스에서만 이루어져 왔다.[2] 동물에서는 아직 이해가 덜 되어 있지만, 꽤 흔할 것으로 예측된다. 이제 초파리(fruit fly)에 관한 새로운 한 연구에 의하면, 한때 깨진 유전자라고 생각했던, 후각 수용체의 위유전자에서 정지코돈 초과번역이 발생하고 있는 것으로 나타났다.[1] 사실 의문시 됐던 위유전자들은 미세 조정된 냄새 탐지에 필요한 기능성 단백질을 생산할 뿐만 아니라, 그것이 필요한 특정 신경세포에서만 생산된다. 따라서 정지코돈 초과번역은 위에서 언급된 다른 인자에 덧붙여서, 세포 내에서 조절되고 있는 것으로 보인다.

연구자들은 초파리의 한 특정 타입에서 기능성 단백질을 생산하는 위유전자를 확인했을 뿐만 아니라, 다양한 후각 수용체 목록의 다른 종들을 확인했다. 이러한 깜짝 놀랄만한 발견으로 인해, 연구자들은 이 분야의 연구가 확대되어야한다고 생각하고 있었다. 논문에서 연구자들은 ”곤충, 사람, 다른 생물에서 화학감각 유전자(chemosensory gene) 계통 내외에서, 조기종결 코돈(PTC)을 가지고 있는 수백 종의 위유전자들 대한 실험적 조사를 신속히 실시해야한다”고 주장하고 있었다.

이 연구는 진화적 산물로서 유전체를 바라보는 것이 과학적 발견에 얼마나 방해가 됐었는지를 보여주는 또 하나의 빛나는 사례가 되고 있다. 만약 과학자들이 유전체를 진화론적 사고로 우연히 생겨났을 것으로 바라보는 것이 아니라, 전능하신 창조주에 의해 설계된 상상할 수 없을 정도로 복잡한 공학적 시스템으로서 바라보았다면, 의도된 목적과 기능을 찾으려했을 것이고, 훨씬 더 생산적인 과학적 발견들이 있었을 것이다.


1.Prieto-Godino, L. L., et al. 2016.Olfactory receptor pseudo-pseudogenes. Nature. 539 (7627): 93-97.
2.Dabrowski, M., et al. 2015. Translational readthrough potential of natural termination codons in eucaryotes—The impact of RNA sequence. RNA Biology. 12 (9): 950-958.


*관련기사 : 가짜로 위장한 가짜유전자 있다! (2016. 11. 11. Science Times)

번역 - 미디어위원회

링크 - 

출처 - ICR, 2016. 11. 14.


생명정보의 비밀

      20세기 이후 생명체 내에는 매우 정교하게 설계된 설계도가 들어 있으며, 이 정보들을 통해 생명체가 자라고, 후손에게 정보가 전달된다는 중요한 사실이 드러났다. 그리고 생명체 내의 정보는 결코 저절로 생겨날 수도 없고, 아무런 지적 개입 없이 정보량이 늘어날 수 없기 때문에 생명정보 자체는 강력하게 지적 원인에 의한 창조를 지지한다. 그럼에도 불구하고 생명이 우연히 발생하여 자연선택과 돌연변이 등을 통해 오랜 시간동안 하등한 생물에서 고등한 생물로 진화해 왔다는 진화론이 과학적 정설로 가르쳐지고 있다. 그러나 생명정보에 관한 최근의 발견들은 이러한 내용을 정면으로 반박하고 있다. 생명체에 들어있는 신비하게 설계된 정보에 관한 내용을 통해 창조설계의 증거들을 살펴보고자 한다.

1. 생명체의 본질은 무엇일까?  ”생명체의 본질로서 정보 통신”[1]

생명체를 구성하고 있는 복잡한 유기물질들일까? 아니면 생명체 내에서 신비하게 전달되고 있는 정보일까? 생명체 내에서는 거의 모든 단계에서 정보의 송수신이 일어나고 있다. 세포의 각 기관들은 DNA와 정보를 주고받기 위해 분자 신호들을 전송하거나 수신한다. 세포와 조직, 기관, 몸과 뇌 사이에는 끊임없이 통신이 이뤄진다. 게다가 새들의 지저귐, 늑대의 울부짖음, 엘크의 우는 소리 등 생물들은 다양한 감각을 통해 정보들을 전달하고 수신한다. 

전기 통신 시스템에서 통신망(network)처럼 생명체 안에서의 신경 통신망은 생체 시계에 맞추어 정밀하게 동기화되어 있다. 최근의 한 연구에서는 ”약 20,000개의 뉴런에 작은 세포기관들이 수면, 배고픔, 체온조절, 호르몬 분비, 유전자 조절 등과 같은 기본 기능들을 조절하며 24시간 몸 전체를 유지 관리하는 방법에 대한 통찰력을 얻을 수 있을 것”이라 기대하고 있다.

나무의 과일 향기
최근 한 보도에서는 나무가 씨앗을 퍼트리기 위해서, 동물을 유혹하는 ‘과일 향기(fruit aroma)’의 역할에 대한 연구 내용을 소개하였다. ”영장류는 쉽고 확실하게 잘 익은 과일을 식별할 수 있고, 대신에 식물은 영장류를 유혹하는 향기를 발산하여 씨앗의 분산을 촉진할 수 있다.”

개미들의 통신 시스템
개미들이 긴 산책로를 지나가면서 더듬이를 서로 접촉하는 이유가 ‘양방향 통신 시스템’을 사용하고 있는 것이라는 연구가 소개되었다. ”개미의 더듬이는 주요한 감각기관이지만, 또한 정보를 전송하는데 사용될 수 있다” 

박쥐의 고주파 청각 신호
박쥐들은 시끄러운 환경 속에서도 난청에 시달리지 않고 고주파의 청각 신호를 방출하고 수신하면서 능숙하게 야간 사냥을 할 수 있다. 

 협조를 구하는 돌고래의 발성
최근의 한 연구에서는 두 돌고래가 양쪽 끝에서 동시에 함께 밧줄을 잡아당겨야 열 수 있는, 먹이가 들어있는 용기를 설치하여 돌고래들이 어떻게 이 문제를 해결하는지를 실험하였다. ”이는 돌고래의 발성이 협력 작업을 위해 사용됐다고 결론내릴 수 있다.”

통신망(Network) 이론에서 가장 중요한 것은 통신망을 구성하고 있는 재료 물질보다는 전송되는 정보와 전달 시스템이다. 통신망을 구성하는 재료를 교체하더라도 같은 정보를 전송할 수 있기 때문이다. 메시지를 편지나 이메일이나 핸드폰 또는 수화나 통역을 통해 보낸다고 하더라도 가장 중요한 것은 전달하려는 메시지 자체인 것과 같은 의미이다. 이렇듯 정보는 정보를 전달하는 재료 물질보다 더 중요하다. 그렇다면 동식물의 세포 내에 들어있는 엄청난 량의 정보를 생각해보자. 생명체를 이루는 물질인 DNA나 단백질들이 자연적인 과정으로 우연히 생겨나는 것은 불가능해 보인다. 그렇다면 더욱더 DNA 내에 들어있는 막대한 량의 유전정보들과 생명체가 가지고 있는 복잡한 전달시스템 역시 우연히 생겨났다고 말할 수 없을 것이다.

2. 정보와 생명체 ”돈돈돈 쓰쓰쓰 돈돈돈”[2]

모스 부호는 문자 정보를 짧은 발신 전류 (·)와 긴 발신 전류(―)의 조합으로 전송하는 무선 통신 방법이다. 모스 부호는 전파뿐 아니라 소리, 빛, 색깔 등 다양한 매개체를 이용하여 전달될 수 있다. 예를 들어 모스 부호로 ”··· ――― ···”라는 신호를 보낸다면 ‘구조요청’이라는 ‘정보’가 매개체인 다양한 ‘물질’에 담겨져서 전달되는 것이다. 만약 모스 부호와 같이 사전에 정해진 약속에 따른 규칙이 없다면, 이 신호가 무엇을 의미하는지 보내는 사람도 받는 사람도 알지 못하는 무의미한 잡음이 될 뿐이다. 

비슷한 예로 시각 장애인을 위해 개발된 점자는 문자 정보를 종이, 금속, 나무 등 다양한 물질의 요철 형태를 이용하여 전달하며, 이 과정에도 철저한 규칙이 있어야만 정보가 전달 될 수 있다. 

정보는 정해진 규칙에 따라 물질의 한 형태로 다른 사람에게 전달되고, 그 사람은 전달된 물질을 보고 그 규칙에 따라 정보를 획득하게 된다. 즉 정보는 물질에 아무런 규칙이나 방향성 없이 우연하게 존재하는 것이 아니라 사전에 철저하게 약속된 규칙이 존재하고, 그 규칙에 따라 정보를 보내고 받는 시스템이 존재해야 하는 것이다. 

생명체내의 모든 ‘정보’는 DNA라는 ‘물질’에 담겨 다음 세대로 전달된다. 모든 생명체는 DNA안에 들어있는 규칙에 따라서 정보를 주고받으며, 이러한 정보가 살이 되고 피가 되고, 이러한 정보에 의해 자녀들이 부모를 닮게 된다. 과연 생명 유지를 위해서 도대체 얼마나 많은 정보가 필요할까? 지난 50여 년간 자연과학자들은 DNA안에 숨겨져 있는 규칙을 알고자 수많은 연구를 거듭해 오고 있지만, 연구를 하면 할수록 얻는 결론은 DNA 정보가 생명현상을 만드는 규칙은 너무나 복잡하고 신묘막측하다는 것이다. 이제는 인간의 능력으로 DNA 정보의 본질을 절대로 다 알 수 없다고 고백하고 있다. 

하나님을 믿지 못하는 사람들은 DNA가 우연히 정보를 만들었다고 주장하지만, 정보는 물질이 만들 수 있는 것이 아니다. 도리어 물질에 정보가 심겨진 것이다. 누가 DNA를 활용하여 정보를 심었고, 이 방대한 정보량을 전달할 수 있는 시스템을 만들었는가? 유전정보를 연구하는 과학자의 한 사람으로서 DNA를 볼 때마다 정보를 창조하시고, 시스템을 설계하신 창조주 하나님의 지혜와 능력 앞에서 겸손해질 뿐이다.

3. DNA는 생명체의 언어이다!  ”DNA : 생명체의 언어”[3]

언어라는 것은 아무렇게나 웅얼대는 것이 아니라 지적 존재에 의해서 생각과 의미들을 전달하는 것이다. 과학자들은 모든 생물체 안에서 명백한 언어(language)를 발견하였다. 극소형 미니어처 도서관처럼, DNA는 꽃잎의 모양에서부터 사람의 눈동자 색깔까지 모든 것들을 상세히 기록하고 있는 놀라운 정보 파일들을 저장하고 있다. DNA는 여러 면에서 하나의 언어를 닮았다. 그것은 마치 생물체들을 만드신 초월적 지성을 가지신 저자가 모든 생물들 안에 지워지지 않는 메시지를 남겨 놓은 것처럼 보인다.

컴퓨터에서 사용되는 이진법의 숫자들처럼, DNA 분자는 뉴클레오티드(nucleotide)라고 불리는 4가지 염기 단위들의 여러 조합들을 사용하여 모든 종류의 정보들을 저장할 수 있다. 4종류의 뉴클레오티드는 20 종류의 아미노산을 만들기 위한 암호로 결합된다. 하나님은 이들 20개의 ‘유전적 알파벳’들을 재배열하시어 생물체가 필요로 하는 모든 단백질들을 만들 수 있는 언어를 디자인하셨다. 마치 영어에 26개의 알파벳들이 있고, 이들 몇 개의 알파벳들로 이루어진 수십만 개 의 단어들이 있고, 이들 단어들을 이용해서 필요한 의미를 전달하는 것과 같다.  

DNA는 믿을 수 없을 만큼의 높은 저장 효율을 가지고 있다. 게다가 세포는 DNA에 저장된 정보에 빠르게 접근하고, 복사하고, 번역할 수 있다. 심지어 DNA는 정확한 정보의 복사를 위해서, 교정을 보며 철자를 검사하는 프로그램을 가지고 있다. 매 100억 개의 뉴클레오티드가 복사되어질 때마다 한번 꼴로 실수가 일어난다. 임의의 사람 2명을 비교하면 유전학적 수준에서 99% 동일하다. 단지 1%의 차이가 전 세계의 사람들 사이에서 나타나는 많은 구별들을 만들고 있다. 우리는 단지 한 무더기의 분자들이 아니다. 우리는 창조주가 불어넣어준 영혼을 가진 독특한 사람들인 것이다.

4. 어떤 저장장치보다 뛰어난 DNA의 정보보관 능력  ”경탄스런 극소형의 설계 : DNA에 집적되어 있는 정보의 양”[4]

오늘날 공학 기술은 매우 발달하여 컴퓨터 하드 디스크, 메모리칩, 광학 디스크 등에 많은 정보들을 고도로 집적시킬 수 있는 기술을 가지게 되었다. 그러나 이 모든 것들은 표면(surface)에 정보들을 저장한다. 이에 반해 DNA는 정보를 3차원적 구조로 저장한다. DNA는 이 우주 내에서 알려져 있는 것 중에서 가장 극도로 고집적되어있는 정보 저장 메커니즘이다. 이러한 믿을 수 없는 고집적 정보저장 시스템의 설계는 초월적인 지적설계자(intelligent Designer)를 가리키고 있다.

더군다나, DNA에 저장되어 있는 그러한 엄청난 양의 정보들이 생물체들의 세대와 세대를 통해 계속 복사되어 후대로 전달되어진다는 것이다! 생물체가 우연히 무기 화학물질로부터 생겨났다는, 그리고 그 안에 들어있는 이 엄청난 정보들도 우연히 생겨났다는 생각을 지지하고있는 어떠한 과학적 법칙도 없다. 반대로 정보(모든 생물체들 안에서 발견할 수 있는 것과 같은)는 언제나 정보를 보낸 지적 송신자가 있다는 것을 가리키고 있음을 우리들은 과학법칙을 통해 알고 있다. DNA를 통해서 생물체를 바라볼 때, 창세기의 창조는 진정한 과학적 증거들과 일치하는 것이다. 이것이 우연히 자연적으로 생겨날 수 있었을까?

5. DNA의 이중 암호  ”듀온 : DNA의 이중 암호는 진화론을 거부한다”[5]

유전체(genome)는 기능을 조절하는 많은 유형의 유전자 암호들을 공급할 뿐만 아니라, 또한 매우 다양한 기능성 RNA 분자들과 단백질들을 만들기 위한 고도로 복잡한 암호화된 주형(templates)을 제공한다. 단백질을 만들기 위한 중요 정보를 포함하고 있는 유전자 암호의 가장 중요한 덩어리 부분은 엑손(exons) 부위이다. 엑손에서 세 개의 연속된 DNA 철자는 하나의 코돈(codon)이라 부른다. 각각의 코돈은 단백질을 이루는 특정 아미노산에 해당하는 암호이다. 유전자에서 코돈들이 길게 나열된 것이 결국 수백 개의 아미노산들로 구성되는 단백질을 만드는 단백질 생성 정보를 포함하고 있다.

그동안 과학자들은 유전자의 단백질 암호 부위 내에는 코돈외에도 다른 미스터리한 신호가 있다는 것을 알고 있었다. 이 신호는 단백질을 만들기 전에 RNA 전사체(유전자 복사본들)를 어떻게 조절하고 처리하는 지를 세포기계들에게 말하고 있었으며, 단백질 주형 암호인 코돈들과는 서로 독립적으로 작동하는 걸로 생각하였다. 그러나 새로운 연구 결과, 이 암호들이 독립적으로 의미를 가지면서도 함께 작동하는 것으로 나타났다. 이 새로운 발견의 결과로서, 엑손에서 이러한 이중 기능을 가진 암호 부위는 ‘듀온(duons)’으로 이름 붙여졌다. 

과학자들은 유전자 암호의 전체 복잡성을 이해하기 위해 투쟁해왔다. 특히 어떤 유전자는 앞으로도 뒤로도 읽혀지는 부위를 가지고 있다는 증거가 발견되었으며, 어떤 유전자들은 유전체에서 다른 유전자들의 부위와 중복되어 있었다. 그리고 이제 많은 유전자들은 같은 동일한 염기서열 내에 이중 암호를 가진 부위가 있음이 밝혀졌다. 가장 뛰어난 최첨단 컴퓨터 프로그래머들과 생물공학자들이 가장 우수한 최첨단 실험실에서, 최첨단 장비들과 최첨단 부품들을 사용한다 하여도, 유전자 암호의 상상을 초월하는 정보 밀도와 초고도 복잡성을 갖춘 프로그램을 만들어낼 수 없다. 그런데 이러한 엄청난 정보량을 가지고 있는, 이중 암호로 된 경이로운 수준의 복잡성을 가진 DNA가 자연적인 과정으로 무기물로부터 우연히 생겨날 수 있었을까? 그럴 가능성은 완전히 제로이다. 오직 초월적 지성의 창조주만이 유전체 내에 들어있는 이러한 놀라운 수준의 생물공학에 대한 유일한 설명이 될 수 있는 것이다.

6. 유전자 이중 암호의 기능  ”유전자의 이중 암호는 진화론을 완전히 거부한다”[6]

단백질은 수백 개의 아미노산들의 사슬로 구성되어 있는데, 이들의 정확한 순서에 대한 명령은 유전자의 단백질 암호 영역에 암호화되어 있다. 코돈(codon)이라 불리는 3개의 염기서열 철자 구조에서 처음 두 염기는 동일하지만, 세 번째 염기는 다를 수 있다. 예를 들어, 4가지 코돈 GGU, GGC, GGA, GGG는 모두 글리신(glycine)이라 불리는 동일한 아미노산에 대한 암호를 나타낸다. 과학자들이 최초로 이 현상을 발견했을 때, 이 3번째 염기의 변이를 ‘동요(wobble)’라고 부르며, 단순히 중복된 다양성으로 폄하했다. 한 아미노산에 대한 모든 다른 변형 코돈들이 기능적으로 동일한 것으로 가정했던 것이다.  

새로운 연구에서 코돈의 3번째 염기의 다양성(variability)은 전혀 중복된 것이 아님이 드러났다. 그것은 단백질이 만들어지는 속도를 조절하며 일시적 중지의 시점을 말하고 있는 특별한 유형의 세포 언어였던 것이다. 궁극적으로 단백질이 적절한 3차원적 입체 구조로 접혀지는 데에 영향을 미치고 있었다.

7. DNA 암호의 3차원적 구조  ”3차원적 구조의 DNA 암호가 발견되다”[7] 

모든 생명체는 세포라는 단위로 구성되어 있으며, 세포 속 핵에는 유전정도를 담고 있는 DNA가 포함되어 있다. 최근 연구에서 DNA 코드의 암호 정보가 3차원 구조를 가지고 있음이 발견되었다. 이는 DNA 코드 역시 진화를 통해 저절로 생겨났다는 진화론의 주장을 원천적으로 무너뜨리는 중요한 사실이다. 유전자들은 전사인자라 불리는 복잡한 네트워크에 의해서 유전체를 가로지르며 켜지고 꺼진다는 것이 알려져 있었다. 이들 전사인자들이 어떤 위치에서 어떤 유전자들과 결합하여 어떤 역할을 하고 있는지를 알아 내는 것은 과학자들에게 커다란 숙제가 된다. 전통적으로 연구자들은 거기에 어떤 일관된 패턴이 있을 것으로 생각하고, 어느 DNA 염기배열이 어느 전사인자와 결합하는지를 이해하려고 노력해왔지만 거의 불가능한 일이었다. 

그러나 이번의 새로운 연구는 DNA가 전사인자들에 의해서 읽혀지는 방법에 영향을 미치는 것이 DNA의 실제 염기서열 외에도 읽혀질 때의 DNA의 구조적 형태라는 것을 밝혀낸 것이다. 즉 DNA를 이루고 있는 4개의 염기(A, T, G, C)들의 순서 뿐 아니라 이들 염기 쌍 사이의 물리적 상호작용에 의해서 만들어지는 DNA의 3차원 구조가 전사인자가 특정 결합 장소를 인식하는데 도움을 주고 있다는 것이다. 이제 DNA 염기순서에만 기초하는 것이 아닌, 또 다른 종류의 암호 즉, DNA의 3차원적(3D) 모양에 기초한 암호가 추가되었다. 선형의 암호와 3D 암호가 함께 작동되어, 유전자 스위치를 켜고 끄는 유전자 발현 분자기계가 정확하게 어느 위치에서 결합해야 되는 지를 지정해주고 있었던 것이다. 

이러한 DNA의 3차원적(3D) 모양에 기초한 암호체계가 있다는 사실은 진화론을 완전히 기각시킨다. 이러한 극도로 정교하고 복잡한 다중 암호 시스템들이 우연히 어쩌다 생겨날 수 있다는 말인가?

8. 이번엔 4차원이다.  ”사람 유전체는 4차원의 세계로 되어 있다”[8]

최근에 새로운 연구에서는 사람의 유전체가 4차원 세계라는 것을 밝히고 있다. 그동안의 연구에서는 사람 유전체(human genome)는 3차원적 동적 시스템의 아름다운 사례임을 드러내었다. 그런데 새로운 연구에서는 ‘염색체 구조 포획(chromosome confirmation capture)’이라는 기법을 사용하여 염색체들이 서로에 대해 어떻게 위치하고 있는지에 대한 유전체 전체의 구조적 정보를 제공하려고 하였다. 여기에다 ‘생체시계(circadian clock)’라고도 불리는 신체의 낮/밤 시간유지 시스템에 대한 반응을 살펴봄으로써 시간(time)이라는 네 번째 차원을 추가한 것이다. 

놀랍게도, 연구자들은 수천의 유전자들이 유전체를 가로지르며 동적으로 그리고 정밀하게 신체의 내부시계에 의해서 조절되고 있음을 발견했다. 이 복잡한 유전자들의 놀라운 관현악 협연은 3D 유전체에 걸쳐서 발생하고 있었다. 수천의 유전자들이 3D 공간 내에서 세포 타입과, 관련된 생리적 과정에 따라 정확한 방법으로 함께 조절되고 있을 뿐만 아니라, 그들은 또한 4차원적 개념인 시간적 상황 하에서 정확하고 경이로운 유전적 댄스를 추면서 기능하고 있었다. 이러한 유형의 생물학적 시스템은 상상을 초월하는 초고도 복잡성을 가지고 있는 것으로, 그것들에 대한 우리의 이해는 이제 시작에 불과한 것이었다.
복잡성은 경이로운 수준이었다. 그리고 이것은 목적도 없고 방향도 없는 무작위적인 우연한 과정을 통해 DNA들이 생겨났을 것이라는 진화론적 패러다임을 완전히 붕괴시키고 있는 것이다. 복잡한 공학적 시스템은 결코 우연히 생겨날 수 없다. 그리고 그 보고서에서 사람의 능력으로는 완전히 이해하기 어려운 수준의 경이로운 초고도 복잡성인 것으로 보인다고 기술하고 있다.

9. 선도적 과학자들이 진화론을 비판하다.

2011년에 ”생물 정보: 새로운 관점”이라는 제목으로 컨퍼런스가 개최되었고, 선도적인 29명의 과학자들은 신다윈주의 이론(Neo-Darwinian theory)의 심각한 문제점들을 지적했다. 진화론에 의하면, 돌연변이(mutations)가 일어나 자연이 생물들을 선택할 때, 새로운 생물학적 정보(new biological information)가 발생한다는 것으로, 그러한 개념이 처음 출현했을 때, 많은 과학자들은 그것이 훌륭한 아이디어라고 생각했었다. 그러나 2011년 회의에 참여한 과학자들에 의하면, 그 이론은 부적절한 것으로 입증되었으며, 이제는 교체될 필요가 있다는 것이다. 

● 유전정보는 자연주의적 과정으로 생겨날 수 없다.[9]

1. 생물학적 정보를 컴퓨터 소프트웨어 및 인간의 언어(human language)와 비교했을 때, DNA 내에 들어있는 유전 암호는 부호, 의미, 구문, 문법, 목적하는 내용 등을 포함하여, 인간 언어의 모든 요소들을 가지고 있다는 것이다. 정보는 생명체에 반드시 있어야하는 필수적인 비물질적 실체(non-material entity)라고 할 때, 신다윈주의와 같은 물질적 메커니즘이 어떻게 생물학적 언어와 같은 비물질적 실체를 생산할 수 있었는지를 묻고 있었다.

2. 세포는 많은 암호들을 사용하고 있으며 (세포는 유전 암호, 짜깁기 암호, 후성적 암호, 기타 암호 등을 사용함), 이러한 암호들은 서로 통신하고 있기 때문에, 물질들에 기초한 어떠한 자연적 과정이 생물학적 정보들을 발생시킬 수 있었다고 하는 주장은 거의 가능성이 없다는 사실을 강조하고 있었다.

3. 신다윈주의는 DNA 정보의 단지 작은 부분이라도 설명해야만 한다고 주장했다. 새로운 실험은 거의 모든 DNA가 정보로 압축되어 있음을 (빈 염기서열과 같은 것은 없음을) 계속해서 확인했다. 그리고 자연계에는 너무도 많은 암호들이 있어서, 이들이 모두 무작위적인 돌연변이 과정으로 쓰여질 수 없음을 확인했다. 세포 내의 여러 중복 유전자 암호(multiple overlapping genetic codes)들은 극도로 복잡해서, 자연주의적 기원이 불가능함을 보여주었다. DNA는 상보적 암호들을 가지고 있는 이중 가닥의 분자들이다. 최근 DNA는 동일한 공간에 다중 암호를 보유하고 있음이 밝혀졌다. 그것은 마치 한 페이지의 암호가 위에서 아래로 읽을 때에 어떤 뜻을 가지고 있지만, 아래에서 위쪽으로 읽을 때에도 완전히 새로운 다른 뜻을 가지고 있는 것과 유사하다. 따라서 하나의 돌연변이가(한 글자를 바꾸는 것과 같은) 동시에 암호화된 메시지 두 개를 변경하여 손상시키지 않고 두 메시지에 모두에서 정보를 추가시킬 수학적 확률은 극히 낮다는 것을 입증했다.

4. 생물학적 정보와 컴퓨터 소프트웨어를 비교했는데, 둘 다 정보를 가지고 있지만, 세포 내에서 정보가 훨씬 더 복잡하다는 결론을 내렸다. 컴퓨터 네트워크가 (관련 하드웨어, 소프트웨어, 언어, 특수 의미 등을 포함하여) 우연히 자연발생할 수 있다고는 아무도 생각하지 않는다. 따라서 그보다 엄청나게 우수한 생물 정보 시스템이 다윈적 시도, 즉 복제 에러 과정으로 우연히 생겨날 수 있다는 주장은 합리적일 수 없다.

생물학적 정보 생성의 어려움과 컴퓨터 시뮬레이션[10] 

1. 자연선택(natural selection)이 정보를 창출할 수 있다는 진화론자들의 디지털 시도, 예를 들면 티에라(Tierra)와 같은 소프트웨어 프로그램에 대한 평가를 요약하고 있었다. 프로그래머가 비현실적이며, 진화론 친화적인 매개 변수들을 소프트웨어 내로 입력한다 하더라도, 컴퓨터 시뮬레이션에서 티에라가 정보를 진화시키는 데에 실패했음을 보여주었다. ‘디지털 진화(digital evolution)’의 증거로 제시된 아비다(Avida)는 진화론자에 의해 아비다 소프트웨어 내로 ”엄청난 양의 초기 단계 설계”를 인위적으로 집어넣었다는 것이 드러났고, 생물학적으로 사실적인 매개 변수가 입력되었을 때, 결국 아무런 정보의 증가도 보여주지 못했다.

2. 자연선택이 새로운 유전정보를 생성할 수 없다는 것을 계산했다. 왜냐하면 모든 진화적 발전은 그 환경에 최적화되어있던 한 때의 특성을 중지시켜야 하기 때문이다. 그래서 수학적으로나 실제 생물학에서 모두 자연선택은 안정화되지 않은, 진화되지 않은 개체를 이끌어낼 뿐이라는 것이다.

3. (생물체를 죽이지는 못하는, 해롭지 않은) 돌연변이가 하나 발생했을 때, 일반적으로 자연선택이 감지하지 못하는 작은 영향만을 끼친다. 다른 말로 해서, 그 개체의 생존력은 집단 내의 이웃한 다른 개체의 생존력과 다르지 않고 동일하다. 하지만 개체군 내에서는 유익한 돌연변이가 간혹 일어난다 하더라도, 작은 손상들이 계속 더해져서, 엄청난 수의 매우 작은 눈에 보이지 않는 해로운 손상들은 압도적인 수가 될 것이다. 이러한 방법으로 유전정보는 지속적으로 감소됨이 확실하다는 것이다.

4. 돌연변이가 어떻게 그리고 왜 기존의 특성을 변화시키는 지, 그리고 자연은 그들 특성 중 어느 것을 선택하는지에 대해서 이론적으로 고찰하였다. 자연선택은 세포 생명체에 이미 필요한 한 유전자를 어설프게 수선할 수 없다. 그래서 진화 생물학자들은 여분의 복사본(extra copies) 가설을 받아들이고 있다. 그러나 우연한 돌연변이에 의해서 복사본이 새로운 유전정보를 얻기 오래 전에, 세포는 이론적으로 생산 및 배송을 멈추고, 여분의 복사본들을 청소해버린다는 것을 발견했다.

세포 내의 유전정보는 증가되지 않고, 소실되고 있다.[11] 

1. 새로운 기능을 이끌어낸다는 돌연변이들에 대한 보고된 논문들을 검토해보았다. 대부분의 돌연변이들은 예를들어 당(sugar) 조절 효소의 능력을 잃어버리는 것과 같은, 기능 손실(loss-of-function)을 일으키고 있었다. 생물체에서 이러한 당 조절 효소의 기능 손실은, 그 당과 유사한 독성 화학물질과 결합할 수 없게 하여, 생존에 도움을 줄 수도 있었다. 그러나 유전정보의 소실이 생물체의 생존을 증가시켰다 하더라도, 정보는 영원히 소실되는 것이다.

2. 자연선택(natural selection)이 생물 정보를 보존할 수 있는지 여부를 시험하여 자연선택은 볼 수 없는 것(표현형으로 나타나지 않은 돌연변이)을 제거할 수 없다는 것을 발견했다. 대부분의 단일 돌연변이는 어떠한 영향력도 미치지 않는 것이 아니다. 이 아주 작은 DNA의 변화는 지속적으로 축적된다. 이것은 마치 자동차가 조금씩 녹슬어가는 것과 같다. 따라서 진화 유전학자들이 자연선택이 어떻게든 생물 정보를 보존할 수 있다고 주장하는 것은 잘못이다. 자연선택은 생물 정보를 보존할 수도 없고, 보존하지도 않는다.

3. 외부 에너지원이 복잡한 정보 시스템의 시간에 따른 붕괴 성향을 반전시킬 수 있다는 진화론적 주장을 반박했다. 예를 들어, 지구에 들어오는 햇빛은 생물체의 분자 구조들을 조직화시키고, 생물체의 레퍼토리를 확장시킬 수 있을까? 질서는 어떤 계(system)의 경계(외부 세계와 그 계 사이의)를 통과하여 지나갈 수 있는 것보다 더 빠르게 안으로 들어갈 수 없다는 것이다. 컴퓨터에 햇빛을 쪼였을 때 새로운 소프트웨어가 만들어지지 않는 것처럼, 살아있는 세포 내에 햇빛의 유입은 생물 정보를 증가시킬 수 없다는 것이다.

4. 생물체 자체에 필요한 에너지가 생물체에 필요한 분자 기계들을 구축할 수 있다는 주장은 오류이다. 세포 내에서 발견되는 분자기계들을 포함하여, 특별한 방법으로 에너지가 어떤 기계들을 만들기 위해서는, 어떤 지능적인 주체가, 또는 로봇처럼 고도로 설계된 기계가 지시를 내려야만 한다.

10. 맺는 글

진화론은 본질적으로 무신론과 유물론에 기초하기 때문에 아무런 지적 원인이 없는 상태에서 물질이 저절로 생겨났고, 생명체 역시 물질로부터 시작되었다고 깊이 믿고 있다. 그렇다면 진화론에서는 생명체 내에 풍부한 유전 정보를 비롯해 아주 복잡한 정보전달 시스템의 기원 역시 물질로부터 찾을 수밖에 없게 된다. 생명체 내에 DNA가 대를 이어 전달되는 복잡한 유전정보를 지니고 있다는 사실은 불과 60여 년 전부터 조금씩 알려져왔으며, 이런 발견들이 유물론적 진화론에서는 매우 풀기 어려운 숙제일 수밖에 없다.

아직도 많은 진화론자들은 물질로부터 정보가 반드시 생겨났어야만 한다고 생각하며, 그 답을 찾으려고 애쓰고 있다. 우연히 생겨난 물질이 점점 복잡해지면서 정보와 정보전달시스템이 저절로 생겨났다는 주장은 도무지 상식적으로도 받아들이기 어렵다. 예를 들면 이런 것이다. 원인이 어디에 있든 간에 매우 복잡한 슈퍼컴퓨터를 만들어 놓으면 이 컴퓨터에서 실행되는 소프트웨어가 저절로 생겨나서 컴퓨터를 가동시킬 수 있다는 주장과 별로 다르지 않다. 

수백 명의 컴퓨터 과학자들이 수십 년 동안 수많은 단계를 거쳐 슈퍼컴퓨터를 만들었고, 이를 가동하는 운영체제 소프트웨어를 만들었다. 그런데도 이보다 만 배쯤은 훨씬 더 복잡한 생명체 내의 정보전달 시스템이 저절로 만들어졌다는 가설을 증명하려고 애쓰는 진화론자들이 얻으려는 것은 무엇일까?

출처 - 제5회 선교사와 목회자를 위한 창조과학세미나 자료집 (2016. 10. 10)

구분 - 4

옛 주소 -

참고 : 6468|6207|6126|6361|6321|6389|6148|5831|6003|5836|5580|5474|6134|5883|5734|5784|5950|5558|5454|5954|5949|6286|5725|5536|5441|5105|5094|5514|3730|512|921|3935|5458|4824|5952|6243|5863|5226|4831|4315|4736|2065|6319|4998|4503|5443|6119|5969|4982|2697|5704|5251|5456|4182|4710|4366|6009|6000

Jeffrey P. Tomkins

유전자 코돈에서 중복/퇴화라는 개념의 몰락 

(Codon Degeneracy Discredited Again)

       진화론의 주요한 믿음 중 하나는 DNA 염기서열의 특정 타입은 자유롭게 돌연변이를 일으켜서, 새로운 기능을 발달시켜 새로운 생물로 진화할 수 있었다는 믿음이다. 이러한 신화적 개념은 유전자의 단백질 암호 영역에 적용되어왔다. 하지만 최근에 이 개념은 동일한 염기순서 내에 들어있는 다중 암호의 발견으로 인해, 그 가능성은 극도로 낮아졌다. 왜냐하면 이중, 삼중의 암호에서 일어난 무작위적 오류는 전형적으로 유해하여, 유전자는 돌연변이를 견딜 수 없게 되기 때문이다. 그리고 이제 또 다른 중요한 묻혀있던 암호가 발견되었다. 그것은 유전자 내에 도처에 있는 변하기 쉬운 DNA(mutable DNA)라는 개념을 완전히 부정하는 것이었다.[1]

단백질들은 특별한 순서를 가진 수백 개의 아미노산들의 사슬로 이루어져 있는데, 이들의 특별한 순서는 염색체의 유전자들 내에 암호로 들어있다. 암호 영역을 함유하는 유전자들의 RNA 복사본은 세포핵 내에서 만들어지고, 핵에서 나와 세포질 내에 있는 리보솜(ribosomes)이라 불리는 단백질 생산 장소로 이동된다. 코돈(codon)이라 불리는, RNA의 3개 염기서열은 단백질을 구성하는 하나의 아미노산에 대한 암호를 가지고 있다. 처음에 과학자들은 코돈에는 중복(redundancy)이 있는 것으로 생각했었다. 코돈 염기서열의 처음 두 개는 같지만, 세 번째 염기서열은 다양함이 발견되었기 때문이다. 예를 들어, 코돈 GGU, GGC, GGA, GGG는 모두 동일하게 글리신(glycine)이라는 아미노산을 만드는 암호이다. 그러나 세 번째 염기는 다르다.

처음에 과학자들은 코돈의 3번째 염기의 다양성을 발견했을 때, 그것을 단순히 중복으로, 코돈의 퇴화라고 생각하고, 그 다양성을 무시해버렸다. 더욱 심각한 것은, 그들은 그것을 진화가 일어나는 하나의 메커니즘이라고 생각했던 것이다. 만약 코돈의 3번째 염기가 최종 결과에 있어서 중립적이라면, 즉 3번째 염기가 아무런 기능이 없는 것이라면, 아마도 그것은 자유롭게 돌연변이를 일으키고, 진화할 수도 있었다는 것이었다. 이러한 개념은 진화의 중립적 모델 이론(neutral model theory of evolution)이라고 불리는 것의 기초가 되었다.

그러나 진화 과학자들이 중복/퇴화(redundant/degenerate)로 여기면서 오랫동안 진화의 가능한 메커니즘으로 생각했던 것이, 지난 수년 동안 일련의 놀라운 발견들로 인해 완전히 부정되었다. 그것은 그러한 주장을 했던 진화론자들이 얼마나 무지했는지를 밝히 드러내고 있었으며, 믿을 수 없도록 경이로운 창조주의 독창성을 보여주는 것이었다. 그리고 밝혀진 것처럼, 코돈의 3번째 염기는 중복이 아니었다. 왜냐하면 그것에 다른 암호가 들어있었기 때문이다. 그리고 한 세트의 암호는 유전자들 내부에서 DNA와 결합하여 유전자의 발현을 조절하는 세포기계 (전사인자라 불리는)를 지정하고 있었다.[2, 3] 또한 단백질이 만들어지는 동안 적절한 접혀짐을 결정하여, 리보솜에서 단백질의 생산(번역이라 불리는) 속도를 결정하는, 코돈 암호들의 또 다른 세트가 발견되었다.[4, 5]

단백질을 만드는데 사용되는 RNA 주형(templates)을 만드는 과정은 전사(transcription)라 불려진다. 가장 최근의 발견은 코돈의 3번째 염기가 유전자 전사 속도와, 생성된 단백질의 상응 량에 따라 만들어지는 메신저 RNA 복사본의 농도를 조절한다는 것을 보여주었다. 즉, 한 유전자로부터 만들어진 생성물의 양은 코돈에 있는 특정 DNA 염기서열과 직접적으로 관련되어 있다는 것이다.

유전자의 생산력은 자동차에서 속도를 제어하는 크루즈-제어(cruise-control) 메커니즘처럼, 세포 내에서 고도로 조절되고 제어됨에 틀림없었다. 만약 유전자가 적절하게 제어되지 않는다면, 세포의 기능 장애는 질병이나 사망을 초래할 것이다. 이제 코돈의 3번째 염기를 포함하여, 코돈의 특정 염기서열은 전사 속도를 제어함으로써, 유전자 조절 과정에서 중요한 역할을 한다는 것이 입증되었다.

코돈에 들어있는 세 가지 다른 타입의 암호들은 서로 겹쳐져 있을 뿐만 아니라, 다양한 세포 기능들을 수행하는 중요한 역할을 하고 있었다. 요약하면, 전체 코돈(3개 염기 모두)은 1)전사 인자의 결합, 2)단백질 생산 속도와 단백질 접힘, 3)유전자 전사 속도와 수준을 조절하고 있다는 것이다.

사람이 생성한 컴퓨터 코드는 단지 한 의미만을 전달하는 선형적 암호이지만, 전능하신 창조주에 의해서 생성된 유전자 암호는 같은 염기서열에서 다중의 복합적 의미와 기능을 갖고 있는 경이로운 수준의 코드였다. 유전암호의 경이로운 복잡성은 목적도 없고, 방향도 없고, 계획도 없는, 무작위적인 돌연변이 대신에, 한 분의 초월적 지혜와 능력의 창조주를 가리키고 있는 것이다.


1. Zhou, Z., et al. 2016. Codon usage is an important determinant of gene expression levels largely through its effects on transcription. Proceedings of the National Academy of Sciences of the United States of America. Published online before print September 26, 2016, doi: 10.1073/pnas.1606724113
2. Tomkins, J. 2014. Duons: Parallel Gene Code Defies Evolution. Creation Science Update. Posted on January 6, 2014, accessed October 3, 2016.
3. Stergachis, A. B., et al. 2013. Exonic Transcription Factor Binding Directs Codon Choice and Affects Protein Evolution. Science. 342 (6164): 1367-1372.
4. Tomkins, J. 2014. Dual-Gene Codes Defy Evolution...Again. Creation Science Update. Posted on September 12, 2014, accessed October 3, 2016.
5. D'Onofrio, D. J. and D. L. Abel. 2014. Redundancy of the genetic code enables translational pausing. Frontiers in Genetics. 5 (140): doi: 10.3389/fgene.2014.00140.

*Dr. Tomkins is Director of Life Sciences at the Institute for Creation Research and earned his Ph.D. in genetics from Clemson University.

번역 - 미디어위원회

링크 -

출처 - ICR News, 2016. 10. 13.

구분 - 4

옛 주소 -

참고 : 6468|6003|6207|6148|5831|5836|5580|5474|6134|5883|5734|5784|5950|5558|5454|5954|5949|6126|6361|6321|6389|4998|4503|5443|6119|5704|5251|5456|4182|4710|4366|6009|6000|6474|6487|6495|6599

Jeffrey P. Tomkins

내부 텔로미어로 보이는 염기서열은 풍부하고 기능적이다. 

(Internal Telomere-like Sequences Are Abundant and Functional)

     오늘날 과학계를 점령하고 있는 진화론에 의하면, 사람과 침팬지는 약 600만 년 전에 살았던 한 공통조상(a common ancestor)으로부터 각각 후손되었다고 주장되고 있다. 이 믿음에 대한 가장 많이 인용되고 있는 증거 중 하나는, 사람의 2번 염색체(chromosome 2)에 있는 (그들의 주장으로) 융합 부위이다. 진화론자들은 두 개의 텔로미어가 융합된 곳에서 퇴화된 잔해를 볼 수 있다고 주장한다. 그들은 이것을 사람의 진화 역사에서 남겨진 자취(leftovers)라고 말한다. 

텔로미어(telomeres)는 식물과 동물의 염색체 말단에서 발견되는 특별한 DNA 염기서열이다. 덜 복잡한 원형 염색체를 가지고 있는 단세포 박테리아의 염색체와 대조해볼 때, 텔로미어들은 커다란 선형의 염색체들을 가진 세포들이 더 복잡한 형태로 존재할 수 있도록 독특하게 설계되어 있다.  

과학자들은 사람 유전체(genome)의 염기서열 분석 시에, 텔로미어 서열 부분들이 염색체의 말단 부위에 독점적으로 있는 것이 아니라, 염색체의 내부 부위에도 존재하는 것을 발견하곤 매우 흥미로워 했다.[1] 처음에, 그러한 ‘간질성 텔로미어 염기서열(interstitial telomere sequences, ITSs)’은 어떤 유용한 목적을 가지고 있지 않은, 유전적 실수로 생각했었다. 사람의 2번 염색체에 있는 유명한 헤드-투-헤드 간질성 텔로미어 염기서열(head-to-head ITS)은 처음에는 두 조상되는 유인원 염색체들의 실수에 의한 융합(an accidental fusion)에 기인한 것으로 추측했었다. 그러나 이러한 추정은 틀렸음이 밝혀졌다. 오늘날 이 특별한 ITS는 촉진유전자(promoter)라고 불리는 일종의 제2의 유전자 스위치로서 기능을 하는, 한 고발현 유전자의 중간 부위에 있는 것으로 알려져 있다.[2, 3] 텔로미어에는 유전자가 완전히 없으므로, 어떤 텔로미어들의 융합이 기능적 유전자를 생성하는 적절한 DNA 염기서열을 제공한다는 것은 불가능하다.

또한 몇몇 과학자들은 ITSs는 유전체에 사실상 위험을 야기시킬 수 있다고 생각했었다. 그리고 연구자들은 ITSs가 질병, 암, 염색체 절단과 관련되어 있는지를 조사해왔다.[1] 그러나 더 많은 연구들에 의하면, 이러한 비정상은 주로 ITSs와 물리적으로 가까이에 있는 다른 염기서열과 관련이 있었으며, 그들의 존재와는 아무런 상관이 없었음을 보여주었다.[1]

놀랍게도 ITSs는 우연히 생겨났다는 진화론적 개념과는 다르게, 설계되었음을 가리키는 강력한 증거들을 보여주고 있다. 염색체의 내부 영역에 존재하는 ITSs는 DNA의 구조적(3차원적) 특성을 변경시킴으로서 유전자 발현에 영향을 주고 있었다.[4] 과학자들은 전형적인 진화론적 사고방식으로, ITSs를 우연한 사고로 생겨난 것으로 전제하고, 그것의 목적과 기능을 찾아보려는 연구 대신에, 유전체에 어떠한 나쁜 영향을 끼치는 지를 연구해왔다. 이러한 역방향적인 접근에도 불구하고, 그들은 결국 ITSs가 유전체내에서 고유한 기능을 가지고 있다고 결론 내렸다.

한편 사람의 2번 염색체의 융합 부위로 주장되는 곳에서, 나는 ITSs가 유전자 발현과 관련된 명백한 하나의 기능을 가지고 있는 요소임을 보여주었다.[2, 3] 따라서, 유전체를 가로지르며 있는 다른 ITSs 부위도 중요한 유전자 조절 기능을 가지고 있을 가능성이 높다. 이러한 생각에 기초하여, 나는 엔코드(ENCODE, ENCyclopedia Of Dna Elements, DNA 백과사전) 프로젝트가 공개한 광범위한 데이터 세트들을 사용하여, 사람 유전체를 가로지르며 존재하는 ITS 부위들을 확인해보았다. 엔코드 프로젝트는 유전체를 가로지르며 있는, 수많은 기능적 DNA 염기서열 데이터들을 제공하고 있다. 그리고 이것은 한 특별한 DNA 염기서열의 기능을 결정하는 데에 이상적이다. 본인의 예비 데이터들은 사람 유전체에 있는 많은 ITS 부위들은 전사인자(transcription factors)라 불리는 특수한 유전자 스위치 단백질의 결합을 포함하여, 유전자 발현(gene expression)과 직접적으로 관련되어 있음을 보여주고 있다.

사람의 2번 염색체에서 융합 부위로 주장되는 곳에 있는 ITSs가 유전자 발현에 관여한다는 발견은, 그 위치가 독특한 부위가 아니라는 것을 보여주고 있다. ITSs(간질성 텔로미어 염기서열)은 사람과 침팬지의 공통조상을 가리키는 것이 아니라, 전지전능하신 창조주에 의한 염색체 내에 공통적 기능적으로 설계된 특성임을 나타내고 있는 것이다.


1.Lin, K. W. and J. Wan. 2008. Endings in the middle: current knowledge of interstitial telomeric sequences. Mutation Research. 658 (1-2): 95-110.
2.Tomkins, J. P. 2013. Alleged Human Chromosome 2 'Fusion Site” Encodes an Active DNA Binding Domain Inside a Complex and Highly Expressed Gene—Negating Fusion. Answers Research Journal. 6: 367-375.
3.Tomkins, J. P. 2015. More DNA Evidence Against Human Chromosome Fusion. Acts & Facts. 44 (8): 10-12.
4.Revaud, D. et al. 2009. Sequence-driven telomeric chromatin structure. Cell Cycle. 8 (7): 1099-1100.

* Dr. Tomkins is Director of Life Sciences at the Institute for Creation Research and earned his Ph.D. in genetics from Clemson University.


*ICR, That’s a Fact. (2분짜리 동영상)

Cell Origins

Chimp DNA

The Secret Code

Useless Body Parts

번역 - 미디어위원회

링크 - ,

출처 - ICR, Acts & Facts. 45(10), 2016

옛주소 :

참고 : 6389|6363|6321|6126|5762|6319|6003|5900|5831|6148|6207|6138|6134|5950|6105|5734|6312|5863|5799|5787|5728|5667|5653|5580|5558|5474|5411|5441|5226|5702|5251|4810|4366|6118|6394|4046|6380|6266|4672|5954|5949|5947


3차원적 구조의 DNA 암호가 발견되다! 

: 다중 DNA 암호 체계는 진화론을 기각시킨다. 

(Three-Dimensional DNA Code Defies Evolution)

by Jeffrey P. Tomkins Ph.D.

      과학자들은 유전체(게놈)에 결합하여 유전자 스위치를 켜고 끄는 전사인자(transcription factors, TFs)라 불리는 단백질들에 대해서 오랫동안 당황해왔었다. 그러나 DNA의 3차원적 모양을 포함한 새로운 한 연구는 상호작용하는 엄청나게 복잡한 생화학적 암호 시스템을 밝혀내고 있었다.[1]

유전자들은 전사인자라 불리는 복잡한 네트워크에 의해서 유전체를 가로지르며 켜지고 꺼진다는 것은 알려져 있었다. 이들 전사인자들은 유전자들 주변과 내부의 전략적 위치에서 DNA와 결합한다. 그러나 전사인자가 결합한 장소에서 무엇이 일어나고 있는지를 발견하는 것은 극도로 어렵다는 것이 입증되어 왔었다. 

전통적으로, 연구자들은 거기에 어떤 일관된 패턴이 있을 것으로 생각하고, 어느 DNA 염기배열이 어느 전사인자와 결합하는지를 이해하려고 노력해왔고, 거기에 초점을 맞춰왔었다. 그러나 이러한 시도는 단지 약간의 성공만을 거두었을 뿐이다. 왜냐하면, 어떤 주어진 전사인자는 다양한 다른 DNA 염기배열들과 결합할 수 있었기 때문이었다. 이것은 그들의 DNA 결합이 고도로 조직 특이성을 보이며 엄격히 조절되고 있다는 사실에도 불구하고 사실이었다. 그 논문의 저자는 말했다. ”유전체 내 표적 장소에 전사인자들이 고도로 특수하게 결합하는 메커니즘은 거의 이해되지 않고 있다.”

그러나 새로운 연구는 DNA가 전사인자들에 의해서 읽혀지는 방법에 영향을 미치는 두 가지 주요한 사실을 밝혀내었다.

1. DNA의 실제 염기서열
2. 그것이 읽혀질 때 DNA의 구조적 형태

이들의 결합 장소에 대한 염기순서는 특정 전사인자와 결합하는 DNA의 조각에 대한 염기서열 분석(sequencing)을 통해서 비교적 쉽게 결정할 수 있다. 그러나 결합에 영향을 주는 두 번째 요인(DNA의 3차원(구조적) 형태)을 발견한다는 것은 쉬운 일이 아니다. 

DNA는 뉴클레오티드라 불리는 4개의 다른 분자들(A, T, G, C로 표현되는)로 이루어진 이중 가닥의 나선이다. 뉴클레오티드 위치 사이의 상호 의존성은 염기 쌍 사이의 물리적 상호작용에 의해서 유래한다. 이러한 상호작용은 DNA의 3차원 구조를 발생시키고, 이것은 차례로 전사인자가 특정 결합 장소를 인식하는데 도움을 주고 있었다.[2] 그 연구에서 연구자들은 관찰했다. ”현재까지 DNA 인식의 형태(모양) 기반 모델의 체계적이고 포괄적인 조사는 부족했다.”[1]

과학자들은 새로운 생화학적 조사에서 얻어진 정보뿐만 아니라, DNA에서 전사인자들의 단백질 결합 생화학에 관해 이전에 연구됐던 광범위한 데이터들을 사용했다. 또한 그들은 모든 데이터들을 습득 평가하는 통계기계라 불리는 기법을 사용하여, 복잡한 알고리즘 개발 시스템을 사용했다. 이러한 세 가지 출처의 정보들은 DNA 염기서열 뿐만 아니라, DNA 형태(DNA shape)를 고려하는 새로운 결합 모델의 개발을 가능하게 해주었다. DNA 염기서열 자체만을 사용하는 표준 모델에 반하여, 그들이 그들의 모델을 시험했을 때, 새로운 시스템은 표준모델을 크게 능가하는 우수한 성능을 보여주었다.

과거 뉴스 보도들은 유전체의 다중 암호(이중 암호)가 DNA 염기서열의 동일한 선형 배열에 포함되어 있었고, 다른 기능들을 수행함을 보여줬었다.[3, 4] 이제 DNA 염기순서에만 기초하는 것이 아닌, 또 다른 종류의 암호가 추가될 수 있게 되었다. 그것은 DNA의 3차원적(3D) 모양에 기초한 암호인 것이다. 선형의 암호와 3D 암호가 함께 작동되어, 유전자 스위치를 켜고 끄는 유전자 발현 분자기계가 정확하게 어느 위치에서 결합해야 되는 지를 지정해주고 있었던 것이다. 

이제 이 새로운 연구 보고서의 또 다른 주목해야만 하는 점은, 이러한 DNA의 3차원적(3D) 모양에 기초한 암호는 진화론을 완전히 기각시키고 있다는 것이다. 진화론은 이러한 놀라운 복잡성을 도저히 설명할 수 없다. 이러한 극도로 정교하고 복잡한 다중 암호 시스템들이 우연히 어쩌다 생겨났는가? 그것은 터무니없고 완전히 불합리한 주장인 것이다. 이러한 놀라운 발견으로부터의 (복잡한 생화학 및 컴퓨터 해석 알고리즘을 사용한) 명백한 합리적인 결론은 초월적 지혜의 창조주께서 이러한 암호 시스템을 설계하시고 만드셨다는 것이다.   


1. Zhou, T., et al. 2015. Quantitative modeling of transcription factor binding specificities using DNA shape. Proceedings of the National Academy of Sciences. 112 (15): 4654–4659.
2. Rohs, R., et al. 2009. The role of DNA shape in protein-DNA recognition. Nature. 461 (7268): 1248–1253.
3. Tomkins, J. 2014. Duons: Parallel Gene Code Defies Evolution. Creation Science Update. Posted on January 6, 2014, accessed April 14, 2015.
4. Tomkins, J. 2014. Dual-Gene Codes Defy Evolution...Again. Creation Science Update. Posted on September 12, 2014, accessed April 14, 2015.

*Dr. Tomkins is Research Associate at the Institute for Creation Research and received his Ph.D. in Genetics from Clemson University.

번역 - 미디어위원회

링크 - 

출처 - ICR News, 2015. 4. 27.


되돌이 후두신경은 형편없는 나쁜 설계가 아니다. 

(Major Evolutionary Blunders 

: The 'Poor Design' of Our Recurrent Laryngeal Nerve)

Dr. Randy J. Guliuzza

     ”당신 또 시작이군요(There you go again)” 1980년 미국 대통령 선거 토론에서 로널드 레이건(Ronald Reagan)이 현직 대통령이었던 지미 카터에게 했던 유명한 말이다. 이 간결한 구절은 모욕은 아니지만, 확실히 듣기 좋은 말은 아니다. 이 말은 상대방의 주장이 진실이 아닌 잘못된 주장이며, 오래된 진부한 주장임을 의미하는 말이다.

최근 월스트리트 저널에 게재된 데이비드 바라쉬(David Barash)의 글에 대해서도 ”당신 또 시작이군요” 라는 말은 적절해 보인다. 그는 '불완전한 복제품'이라는 제목의 글에서, 사람의 몸(human bodies)은 잘못 설계된 모든 것들 중에서 으뜸이라는 오래된 진화론적 주장을 앵무새처럼 되풀이하고 있었다.[1] 진화 심리학자인 바라쉬는 제레미 테일러(Jeremy Taylor)의 책 ‘진화된 몸(Body by Darwin)’을 리뷰하며 흥분하고 있었다. 그 책은 사람의 몸이 진화적 역사를 어떻게 반영하고 있는지에 대한 몇 가지의 주장되는 예들을 나열하고 있었다. 많은 진화론자들은 생물체에서 '형편없는 설계(poor design, 나쁜 설계)'라는 것들이 창조론을 반대하며 진화론을 지지하는 과학적 증거라고 믿고 있다. 그러나 그러한 사고는 많은 문제점들을 가지고 있다.

지적인 설계자가 형편없는 설계를 하지 않았을 것이라는 의견은 본질상 과학적인 주장이 아니라, 신학적인 주장이다. 그럼에도 불구하고, 많은 진화론자들은 형편없는 설계의 증거를 찾아내는 일이 과학적 연구라고 믿고 있다. 그러나 형편없는 설계로 말해지고 있는 구조들도 진화론적 추정과 외삽(즉, 상상)들과 비교해보면 극히 일부분이다.[3] 그리고 객관적인 실험으로 '형편없는 설계'가 입증된 적은 없다. 그렇다면, 어떻게 진화론자들은 한 구조를 보고 형편없는 설계라고 주장하고 있는 것일까?

‘형편없는 설계’라는 주장은 어떤 생물체를 보고 ‘원시적’이나, ‘전이형태’라고 말하거나, 또는 ‘자연선택의 사례’, ‘수렴진화의 사례’라고 주장하는 것과 유사한 것이다. ”당신 또 시작이군요”에 해당하는 이러한 주장은 명백한 관측에 의해서 이루어진 실체가 아니라, 모두 상상에 의한 추정적 해석이다. 그러나 자연주의적 세계관을 가진 세속적 과학자들은 자연에서 이러한 형편없는 설계를 찾기 위해 애쓰고 있다.


진화론자들은 자연이 생물들을 무작위적으로 서툴게 고쳤을 것이라고 믿고 있다.

형편없는 설계라는 개념은 생각(뇌)이 없는 자연(mindless nature)이 생물들을 창조해냈다는 개념과 분리될 수 없다. 자연은 어떻게 생물들의 형태를 결정하는가? 최근에 보스턴 대학의 진화 생물학자 데이비드 레빈(David Levin)은 자연이 어떻게 생물들을 천천히 조각들을 함께 붙여나가는 지를 설명하고 있었다. 첫째, 생물의 DNA에서 무작위적인 돌연변이는 자연의 힘에 의해서 발생한다. 후에 자연은 부적합한 것에 대해서 죽음이라는 비용을 지불하고, 오직 최적자로 생존한 개체를 선택한다. 그리고 이러한 방법으로 ‘자연선택(natural selection)‘은 환경에 따라 유전체를 조각한다.'[4]

조각한다고(sculpting)? 독자들은 미켈란젤로의 작품처럼 예술가가 심혈을 기울여 조각하는 행동으로 잘못 생각할 수도 있을 것이다. 그와는 대조적으로 레빈의 조각은 장구한 세월에 걸친 투쟁과 죽음을 통해 덧붙여진 수억 수천만 개의 유전적 개조를 의미한다. 레빈의 그러한 상상의 조각 과정에 대한 유일한 증거는 그의 생각으로 형편없어 보이는 여러 설계들이 존재한다는 것이다. 그러나 조각 과정이나 형편없는 설계로 분류하는 일은 객관적인 관측에 기초한 것이 아니다.

레빈과 같은 진화론자들은 이 보편적인 과정이 본질적으로 계획되지 않은, 무작위적인 것으로, 뒤죽박죽일 것으로 믿고 있다. 두 진화 생물학자들은 ”다중 협력 전사인자가 발달 조절자의 존재에 유리하게 작용한 병합된 결합부위를 포함하여, 함께 서툴게 수선된 조절(유전자) 요소들이 흔하게 나타날 것이라고 믿고 있다.”[5] 다른 진화 연구자들은 ”유악류 및 무악류 척추동물의 헤모글로빈은 독립적으로 발명됐다는 발견은, 서툴지만 다른 재료들을 사용하여 유사한 설계를 만들어낼 수 있는 자연선택의 능력이 강력함을 보여주는 것”이라고 주장한다.[6] 자연이 어떤 것을 조사하고 채택할 수 없음에도 불구하고, 진화론자들은 자연선택이 자연에 놀라운 창의력과 전략을 제공할 수 있다고 쉽게 생각해 버린다.

사람의 신체 구조에서 '형편없는 설계'의 목록에는 DNA 자체 뿐만 아니라, 일련의 혈액 응고 반응과 같은 분자적 특성들과, 눈(망막), 목, 산도(birth canals) 등이 포함된다. 또한 진화론자들은 우리의 목에 있는 한 긴 신경인 되돌이 후두신경(recurrent laryngeal nerve, RLN)이 형편없는 설계를 보여줄 뿐만 아니라, 오래 전에 물고기로부터 후손됐음을 가리키는 증거라고 주장하고 있다. 과학적 지식이 축적됨에 따라, 이러한 주장들은 진화론자들의 무지로 인한 실수였음이 밝혀지고 있다. 최근 조사에 의하면, 되돌이 후두신경이 형편없는 설계의 사례라는 진화론자들의 주장이 이전의 실수처럼 또 하나의 실수였음이 밝혀진 것이다.

되돌이 후두신경은 부적응된 것인가?

후두에 있는 성대(vocal cords)는 좌우의 후두신경(laryngeal nerves)에 의해서 지배받는다. 이들 신경은 뇌신경의 하나인 미주신경(vagus nerve)에서 분기된다. 왼쪽에서 미주신경은 두개골에서 시작하여, 목 아래로 심장을 향해 내려간다. 되돌이 후두신경은 대동맥(aorta) 바로 아래에서 미주신경과 분기되어 나뉘어진다. 대동맥 아래를 고리처럼 돌아, 되돌이 후두신경은 위쪽으로(되돌아) 올라가며 여러 장기들을 제어하며, 후두에 도달한다. 진화론자들은 왼쪽 되돌이 후두신경이 후두 가까이에서 분기되지 않은 것은 형편없는 설계라고 주장한다. (왼쪽 RLN이 오른쪽 RLN 보다 더 길지만, 각 신경 신호들을 조정되어, 성대는 동시에 자극되고, 정상적 발성이 이루어진다는 것을 주목하라.)

시카고 대학의 진화론 명예 교수인 제리 코인(Jerry Coyne) 박사는 형편없는 설계에 대한 그의 목록에 되돌이 후두신경을 열거하고 있었다. ”진화가 사실인 이유”라는 책에서, 그는 ”자연계에서 최악의 형편없는 설계 중 하나가 포유류에서 이 되돌이 후두신경이다” 라고 주장했다. ”이 이상한 신경은 필요한 것 이상으로 훨씬 더 길다(약 60cm).” 그는 후에 덧붙였다, ”이 되돌이 후두신경의 우회 경로는 형편없는 설계일 뿐만 아니라, 심지어 부적응의 사례일 수 있다.”[7]

그는 그 신경 경로에 대한 유일한 합리적인 설명은 그것이 원래 물고기의 아가미에서 시작했기 때문이라고 주장한다. 나중에 물고기에서 양서류가 진화했고, 파충류와 포유류는 양서류로부터 진화했다. 그 다음에, 그는 말했다. ”사람의 진화 동안에 우리의 심장은 대동맥의 역진화를 유지하기 위해 가슴 쪽으로 이동했다. 따라서 후두신경은 길게 늘어나게 되었고, 우리의 후두(물고기는 가지고 있지 않은)로 위쪽으로 되돌아갔다.”[7]

고생물학자인 도널드 프로테오(Donald Prothero)도 동일한 주장을 하고 있었다. ”그러한 설계는 낭비적이다... 뿐만 아니라, 이 신경의 기괴한 경로는 진화적 측면에서 완벽하게 의미가 있는 것이다. 물고기와 초기 포유류 배아에서, 되돌이 후두신경의 전구체는 목의 깊은 부위에 있는 여섯 번째 아가미활(gill arch)에 부착되어 있었다.”[8]

되돌이 후두신경의 구조는 진화론을 찬성하는, 형편없는 설계의 부정할 수 없는 증거로 간주되며 대대적으로 선전되고 있었다.

되돌이 후두신경 : 진화론자들의 주장은 완전히 잘못된 것이다!

십 년 이상 전에 출간된 프로테오나 코인의 책에 쓰여진 문헌들은 되돌이 후두신경이 대동맥 궁 아래를 지나 고리처럼 되어있는 것에 대한 아주 좋은 이유를 설명해주고 있었다. 되돌이 후두신경은 태아의 출생 전 발달 동안에 몇몇 핵심적인 역할을 수행하고 있다. 그들 중 하나는 매우 중요하며, 흥미롭다.

배경 설명을 하자면, 태아가 어머니의 자궁에서 발달하는 동안, 양수 속에서 살아가고 있으므로, 태아의 폐는 산소 교환을 위해 작동되지 않는다. 따라서 대부분의 피는 폐로 가지 않고 어떤 임시적인 지름길(temporary shunts)을 통해서 지나간다. 하나의 지름길이 폐동맥과 대동맥을 연결하고 있는, 근육 벽으로 이루어진 한 작은 동맥이다. 그것의 라틴어 이름은 동맥관(ductus arteriosis)이다. 아기가 출생을 하여 첫 번째 숨을 쉬면, 그 동맥은 특정 신호를 감지하고, 그 동맥관을 폐쇄시키기 위해서 근육 벽을 수축시킨다. 이제 혈액은 폐로 강제로 송출되는 것이다. 왜 동맥관은 다른 동맥들에 비해 훨씬 더 적은 탄성 섬유들의 근육 벽으로 되어 있는 것일까?

존스 홉킨스 의과대학의 연구자들은 태아의 발달 동안 ”왼쪽 미주신경과 되돌이 후두신경의 분기(나눠짐)는 좌측 여섯째 대동맥 궁의 말단(또는 동맥관 구성요소)을 지지하는 하나의 고리(a sling)를 형성한다”는 것을 발견했다. 놀랍게도, 연구자들은 자신들의 연구에서 다음과 같은 것을 발견했다 :

지지하는 신경 아래에 있는 동맥관의 중막(media, 혈관 벽의 구성물)은 더 얇고, 인접한 대동맥 궁의 탄력적인 층판 중막보다 적은 탄성 섬유를 갖고 있다. 이 연구는 미주신경과 되돌이 후두신경이 태아의 발달 동안에 동맥관을 기계적으로 지지하고(mechanical support) 있는 위치에서 있으며, 지지되고 있는 동맥관의 중막의 형태(또는 구성물)가 인접한 지지되지 않는 대동맥 궁의 중막의 형태와 차이가 있음을 보여주고 있다. 이 부위의 기계적 지지는 정상적 동맥관이 하나의 근육성 동맥으로 차별화되는 이유가 될 수 있음을 가리킨다. 따라서 출생 후에 그 내강을 폐쇄시킬 수 있는 것이다. 그러한 지지가 없었다면, 동맥관 중막은 지지되지 않는 정상적인 대동맥이나 폐동맥 가지들처럼 풍부한 탄성 섬유들을 발달시켰을 것이다. 그래서 출생 후에도 폐쇄되지 않아, 동맥관 개존증(patent [or open] ductus arteriosus)이라는 비정상적인 질환을 갖게 될 것이다.[9]  

태아 발달에 관한 이러한 최근 연구에 의하면, 되돌이 후두신경이 정확한 기계적 지지를 제공함으로서, 태아의 발달 동안 동맥관이 정확하게 형성되었다가 출생 후 폐쇄되도록 하는, 매우 현명한 메커니즘인 것으로 보여진다. 이 되돌이 후두신경은 좌측 성대를 조절하는 것 외에, 다중의 목적이 있었던 것이다. 그 신경의 길이, 위치, 기능 모두는 천재적인 설계로서, 형편없는 설계가 아니었던 것이다. 우리 몸에서 되돌이 후두신경의 위치가 오래 전의 물고기 조상으로부터 기인됐다는 주장은 또 하나의 커다란 진화론적 실수이며 오류인 것이다.

'형편없는 설계'라는 주장은 무지로부터 생겨난 주장이다.

진화론자들이 '형편없는 설계'라는 주장을 할 때, 대체적으로 그러한 구조에 대한 지식이 매우 부족하다는 것을 보여준다. 비판가들은 사실 그 구조에 대한 최근의 연구 결과들에 대해서 잘 알지 못하고 있다. 그들은 자신들이 비판하는 구조에 대한 정확한 기능에 대해 무지하며, 그들의 주장에는 여러 다른 문제점들도 들어 있다.

설계적 관점에서, 되돌이 후두신경에 대한 진화론자들의 실수는 여러 상충적 요인들에 대해 균형을 맞출 필요에 대해 그들이 알지 못하고 있음을 명확하게 보여준다. 설계에서 이러한 원리는 최적화(optimization)로 알려져 있다. 진화론자들이 놓치고 있는 것이 있는데, 설계는 단지 어떤 하나의 특성만을 최대로 수행하기 위해서 이루어지는 것이 아니다. 진화론자들은 어떤 실체가 전체적으로 설계되었는지 아닌지를 살펴보려고 하지 않는다. 그들은 아직 발견되지 않은 다른 기능들뿐만 아니라, 여러 특성들을 두루 살리기 위한 설계적 교환(tradeoffs)을 무시하고 형편없는 설계라고 비판한다. 여러 기능을 갖게 하는 설계적 교환 작업은 어려운 일이다. 그것은 하나의 설계 뒤에 또 다른 설계가 들어있는, 지성(intelligence)에 대한 강력한 증거인 것이다.   

그리고 형편없는 설계가 사실이라 하더라도, 그것이 설계 자체를 부정할 수는 없는 것이다. 사람에 의해서 설계된 제품들을 보면, 간단한 것에서부터 극도로 복잡한 제품까지 다양하다. 제품의 품질이 지적설계의 여부를 결정하는 것이 아니다. 천재적인 설계도 최고의 품질을 요구하지 않을 수 있다. 어떻게 설계됐는지에 대한 논란은, 설계되었는지 안 되었는지에 대한 논란과는 아무런 상관이 없는 것이다.

형편없는 설계 : 진실인가, 상상인가?

애비 하퍼(Abby Hafer)는 그의 책 ”지적이지 않은 설계자: 사람의 몸을 지적설계가 아닌 진화로 설명하는 이유”에서 이렇게 주장하고 있었다.[10] ”케네스 밀러는 복잡한 생화학적 경로는 한때 다른 기능을 가지고 있었지만 새로운 용도로 공동 선택됐던, 원시적 전구체 단백질로부터 함께 서투르게 수선되었음을 보여주고 있다.”[11] 당신 또 시작이군요.

진화론자들의 글을 읽을 때, 독자들은 사실을 잘못 이해하고, 왜곡하고 있으며, 관측이 아닌 추정으로 일관된 유해한 글들을 읽고 있다는 사실을 기억해야 한다. 그러한 글들은 습관적으로 자연이 어떤 일을 계획하고, 발명하고, 모으고, 서툴게 수선할 수 있는 것처럼, 의인화하고 있다. 그리고 자연선택이 어떤 환경에서 유전체를 바꾸고 조각할 수 있는 것처럼 말한다.[12] 다윈의 진화적 과정은 진화론자들의 마음속에만 있는 환상과 같은 것이다. 진화론을 현실 세계로 도입할 때, 서로 충돌하며, 많은 오류들과 문제점들을 초래하는 것은 이상한 일이 아니다.

세계관이 중요하다. 창조론자들은 사람이 만든 복잡한 물건과 지구상에서 살아가는 생물들은 유사한 특성들을 가지고 있기 때문에, 그것들 모두는 설계되었고, 목적을 가지고 만들어졌다고 추론한다. 환경적 인자들은 지능이 없고, 계획할 수 없고, 어떤 설계를 할 수 없기 때문에, 그것만으로 어떤 간단한 장기라도 생겨나게 할 수 없다. 생물체의 어떤 장기가 형편없는 설계라는 주장은 사실상 설계를 인정하고 말하는 주장이다. 실제로, 생물들은 숨이 멎을 만큼의 경이롭고 완벽한 장기들과 구조들을 가지고 있다. 생명체의 복잡성과 완벽에 가까운 기능들은  대부분의 사람들에게 분명히 보여 알려졌으며(롬 1:20), 정말로 경이로운 수준의 것들이다.[14]


1. Barash, D. Imperfect Reproductions. The Wall Street Journal. Posted on January 29, 2016, accessed February 4, 2016.
2. Taylor, J. 2015. Body by Darwin: How Evolution Shapes Our Health and Transforms Medicine. Chicago, IL: The University of Chicago Press.
3. Guliuzza, R. J. 2015. Major Evolutionary Blunders: The Imaginary Piltdown Man. Acts & Facts. 44 (12): 12-14.
4. Spetner, L. M. Information and mutation—Responding to David Levin. Evolution News and Views. Posted on February 2, 2016, accessed February 5, 2016.
5. Hersh, B. M. and S. B. Carroll. 2005. Direct regulation of knot gene expression by Ultrabithorax and the evolution of cis-regulatory elements in Drosophila. Development. 132 (7): 1567-1577.
6. Simons, T. Biologists find that red-blooded vertebrates evolved twice, independently. University of Nebraska-Lincoln news release. Posted on July 26, 2010 accessed February 9, 2016.
7. Coyne, J. 2009. Why Evolution Is True. New York: Viking, 82-84.
8. Prothero, D. R. 2007. Evolution: What the Fossils Say and Why It Matters. New York: Columbia University Press, 37-38.
9. Leonard, M. E., G. M. Hutchins and G. W. Moore. 1983. Role of the vagus nerve and its recurrent laryngeal branch in the development of the human ductus arteriosus. American Journal of Anatomy. 167 (3): 313–327.
10. Hafer, A. 2015. The Not-So-Intelligent Designer: Why Evolution Explains the Human Body and Intelligent Design Does Not. Eugene, OR: Cascade Books.
11. Coyne, J. A. Seeing and Believing: The never-ending attempt to reconcile science and religion, and why it is doomed to fail.The New Republic. Posted on February 3, 2009, accessed December 29, 2015.
12. Spetner, Information and mutation—Responding to David Levin.
13. Guliuzza, R. J. 2010. Fit & Function: Design in NatureActs & Facts. 39 (2): 10-11.
14. For an informative review of the important role of the RLN, see Bergman, J. 2010. Recurrent Laryngeal Nerve Is Not Evidence of Poor Design. Acts & Facts. 39 (8): 12-14.

* Dr. Guliuzza is ICR’s National Representative.

Cite this article: Randy J. Guliuzza, P.E., M.D. 2016. Major Evolutionary Blunders: The 'Poor Design' of Our Recurrent Laryngeal Nerve. Acts & Facts. 45 (4).

*참조 : 기린의 나쁜 디자인 -  (Youtube 동영상)  (‘되돌이 후두신경’이 형편없는 설계라고 주장하는 도킨스)

번역 - 미디어위원회

링크 - 

출처 - ICR, Acts & Facts. 45 (4), 2016.


정크 DNA가 기능이 있음이 또 다시 확인되었다. 

: 모티프라 불리는 DNA의 직렬반복과 유전자 발현 

(Junk DNA…Trashed Again)

by Jeffrey P. Tomkins Ph.D.

     사람 유전체(human genome)에 들어있는 30억 개의 염기서열에서 반복되고 있는 '단어(word)'는 절반 이상이나 된다.[1] 언어에서 반복되는 단어는 오류로 보고 있기 때문에, 인간적인 생각으로 이러한 DNA 염기서열은 의미 없는 쓰레기(junk)로서 간주됐었다. 세속적 과학자들은 오랜 기간에 걸친 자연적 과정이 어떻게든 오류의 중복을 만들었고, 이러한 오류들이 쓸모없는 짐이 되어 유전체에 남아있어 전달되고 있다고 가정했었다. 그러나 이제 이러한 반복적인 단어들은 여러 생화학적 기능과 연결되어 있는 것으로 밝혀졌다.[1]

최근 뉴스에서 강조되고 있는, 사람 유전체(human genome) 염기서열에서 반복되고 있는 부분은 직렬반복(tandem repeats, TRs)이라 불리는 것이다. 이들은 모티프(motif)라 불리는, 머리-꼬리 패턴으로 배열된 '단어'의 두 개 또는 그 이상의 연속된 복사로 구성된 DNA의 확장 부분이다. 예를 들어, TR 'ttacttacttacttacgttac'은 단지 네 개의 모티프 'ttac'가 5회 반복되고 있다. 놀랍게도, 이러한 TRs는 유전자 안쪽, 바깥쪽, 심지어 유전자의 단백질 암호 부위 내부까지, 사람 유전체의 모든 부분에서 발견된다. 사람 각 개인별로 많은 TRs 들의 반복되는 길이는 다양하다. 그것은 법의학에서 범인이나, 친부모를 확인하는 데에 매우 효과적인 DNA 표지자(DNA markers)로서 사용되어왔다.

과학자들이 이 TR 시퀀스에 대해 알고 있었음에도 불구하고, 그리고 그것들을 신뢰할 수 있는 유전자 표지자로 사용해왔음에도 불구하고, 그것들의 실제적 기능에 대해서는 거의 알지 못하고 있었다. 언뜻 보기에 조금 이해되지 않는, 이들 비정상 같은 반복되는 염기서열 부분은 역사적으로 종종 ‘정크 DNA(junk DNA, 쓰레기 DNA)’로 취급되어 왔었다.

그러나 최근 한 그룹의 연구자들은 다른 접근 방식을 취했고, 이러한 서열이 어떤 목적을 가지고 있을 수도 있다는 가설을 세웠다. 그들은 유전자 발현과 DNA의 후성 유전학적 변화(epigenetic modification)에 있어서 TRs의 효과를 시험해보기 위한 실험 세트를 개발했다. 후성 유전학적 변화는 실제의 DNA 염기서열을 변경하지 않고, DNA 분자에 분자적 꼬리표(tags)를 추가하는 것이다. 그 결과 유전자 발현(gene expression)이 변경된다.

현재의 그리고 새롭게 얻어진 일련의 데이터들을 사용한 광범위한 실험을 실시한 후에, 연구자들은 ”우리의 결과는 사람 유전체에 있는 수천의 TR 변이들이 아마도 국소적 유전자 발현의 변경, 또는 후성유전학(epigenetics)을 통해서 기능적 효과를 발휘하고 있을 가능성을 제시한다”고 선언했다. 그들은 또한 이렇게 말했다 :

우리의 연구는 사람 유전체에서 TR 변이(TR variations)의 생물학적 중요성을 보여주고 있다. 그리고 TR 변이의 상당 부분이 국소적 유전자 발현이나, 후성유전학의 변경을 통해서 기능적 효과를 발휘하고 있음을 제시한다. 우리는 유전체에서 완전한 기능적 변화를 확인하기 위해서, 유전자형(유전자 시험) TR 변이에 초점을 맞춘 연구들이 필요하다는 결론을 내린다.[1]

이러한 새로운 데이터는 인간의 질병과 관련한 TRs의 기능적 역할에 대한 증거들을 밝혔던 다양한 이전 연구들을 확증해주고 있었다. 이것이 입증됨으로서, 수십 가지의 사람의 유전질환들은 유전체의 단백질 암호 또는 비암호 부위에서 커다란 반복적 확장과 직접적으로 연결되어 있을 수 있다.[2] 분명히, 이들 부위는 엄격한 유전적 조절 하에 있다. 그러한 반복이 허용되는 변이의 길이 한계를 넘었을 때, 질환이 생기는 결과를 초래할 수 있다.

다시 한 번 우리는 유전체에서, 한때 과학자들이 그 기능을 알지 못한다는 사실 만으로, 진화 도중에 남겨진, 기능이 없는 정크(쓰레기)라고 불렀던 DNA의 부분들이 분명한 기능들을 가지고 있다는 사실을 확인할 수 있었다. 진화론자들은 이해하지 못하고 알지 못하는 부분들에 대해서 적절한 답을 가지고 있는 것처럼 추정적인 이야기들을 남발해 왔었다.  

유전체 연구에 있어서, 지적설계에 기초한 접근 방식이 더 널리 받아들여졌었다면, 현재에도 알지 못하는 기능들에 대한 우리의 이해가 얼마나 많이 발전해 있었겠는가? 그러한 시도들은 초월적 지혜를 가지신, 위대한 설계자이자 공학자이신, 창조주 하나님께 영광을 돌렸을 것이다.


1. Quilez, J. et al. 2016. Polymorphic tandem repeats within gene promoters act as modifiers of gene expression and DNA methylation in humans. Nucleic Acids Research. 44 (8): 3750-3762.
2. Gemayel, R., M. D. Vinces, M. Legendre, and K. J. Verstrepen. 2010. Variable tandem repeats accelerate evolution of coding and regulatory sequences. Annual Review Genetics. 44: 445-477.

*Dr. Tomkins is Director of Life Sciences at the Institute for Creation Research and earned his Ph.D. in genetics from Clemson University.

번역 - 미디어위원회

링크 - 

출처 - ICR News, 2016. 5. 26.

서울특별시 종로구 창경궁로26길 28-3

대표전화 02-419-6465  /  팩스 02-451-0130  /

고유번호 : 219-82-00916             Copyright ⓒ 한국창조과학회

상호명 : (주)창조과학미디어  /  대표자 : 박영민

사업자번호 : 120-87-70892

통신판매업신고 : 제 2021-서울종로-1605 호

주소 : 서울특별시 종로구 창경궁로26길 28-5

대표전화 : 02-419-6484

개인정보책임자 : 김광