LIBRARY

KOREA  ASSOCIATION FOR CREATION RESEARCH

창조설계

Robert Carter
2019-07-03

4차원으로 작동되고 있는 사람 유전체 

: 유전체의 슈퍼-초고도 복잡성은 자연주의적 설명을 거부한다. 

(The four dimensional human genome defies naturalistic explanations)


      사람 유전체(human genome)는 우주 내에서 알려진 것들 중에서 가장 복잡한 컴퓨터 운영 시스템이다. 그것은 단일-분자적 정밀성으로 작동되는 초고도-복잡성의 생화학을 제어하고 있다. 유전체는 수십만 개의 단백질들의 양방향 네트워크를 조절하고 있다. 그것은 하나님의 경이로운 창조적 능력을 보여주는 동시에, 신다윈주의 이론의 과학적 파산을 가리키는 훌륭한 증거가 되고 있다. 그 이유는 무엇인가? 왜냐하면, 생명체의 복잡성이 점점 더 커질수록, 무작위적인 자연적 과정에 의한 진화론은 점점 더 그 가능성이 낮아지기 때문이다. 초고도 복잡성의 기계는 계획도 없고 방향도 없는 어떤 사고들에 의해서 우연히 생겨날 수 없다. 어떤 사고는 고장을 유발하지, 더 성능 좋은 기계로 변화시키지 못한다. 그리고 슈퍼-초고도 복잡성의 기계는 더더욱 무작위적인 변경으로 생겨날 수 없다.

그림 1 : 대장균(E. Coli, 왼쪽)과 리눅스 호출 그래프(Linux call graph, 오른쪽)의 전사 제어(control of transcription)의 비교. 대장균 세포는 비교적 적은 제어를(노란색 선과 보라색 선) 통해 많은 단백질 암호 유전자(하단의 녹색 선)들을 제어할 수 있다. 이에 비해 (명백한 지적설계의 결과인) 리눅스는 대장균에 훨씬 못 미치는, 비교적 적은 결과물을 제어하기 위해서, 훨씬 많은 고수준의 지침들을 필요로 한다.(From Yan et al. 2010.) [1]


컴퓨터 프로그램은 기본적으로 1차원이다. 사람의 유전체는 4차원으로 작동된다. 이것은 하나님의 창조적 능력이 얼마나 위대하신지를 보여주는 가장 강력한 증거 중 하나이다.

나는 유전체를 컴퓨터 운영시스템과 비교해보았을 때, 커다란 충격을 받았다. 이 둘을 비교해보았을 때, 이 세상의 어떤 컴퓨터도 유전체의 복잡성이나 효율성 측면에서 비교될 수 없었다. 그 비교도 가장 기초적 수준에서만 이루어질 수 있었다. 유전체는 극도로 복잡하고, 지속적으로 효율적으로 작동되고 있었다. 컴퓨터공학자들은 수많은 시간 동안 모든 기술력과 정보와 지식을 통해 프로그램들을 만들어낸 후에, 노트북이나 서버를 실행할 수 있는 운영시스템을 구축하게 된다. 그러나 그것도 결국 많은 장애들이 발생하고, 운영에 에러가 생긴다. 그러나 유전체에 들어있는 프로그램은 인체라 불리는 초고도 복잡성의 생물학적 기계를 완벽하게 운영 작동시키고 있다. 이 두 조직은 물론 근본적으로 다르다.


컴퓨터 과학자, 생물 물리학자, 생물 정보학자들로(정말로 똑똑한 사람들로) 구성된 한 연구팀은 하등한 대장균 박테리아의 유전체를 사람들이 만들어낸 리눅스(Linux) 운영 시스템과 비교해보았다(그림 1). 그리고 사람들이 만든 리눅스 운영 시스템이 훨씬 많은 상위 지침들을 가지고 있기 때문에, 훨씬 더 비효율적인 시스템이라는 것을 발견했다. 박테리아 유전체는 적은 수의 상위레벨 지침들을 가지고, 적은 수의 중간레벨 지침들을 제어하고, 이들은 많은 수의 단백질 암호 유전자들을 제어한다. 리눅스는 그 반대이다. 리눅스는 훨씬 많은 상위레벨 및 중간레벨의 지침들을 가지고 있으면서도, 매우 비효율적으로 그것을 제어한다. 대장균은 적은 제어로 많은 일을 할 수 있는 것이다. 유전체학(genomics)의 연구는 미래에 컴퓨터 발전에 커다란 영향을 미칠 것으로 예측되고 있다.


또한, 사람이 만든 컴퓨터는 비교적 간단한 프로그램을 사용한다. 컴퓨터 프로그래머는 '코드 라인 수(lines of code)'에 대해서 이야기한다. 우리는 수학 시간에서 선(line)은 1차원이라는 것을 배웠다. 그래서 컴퓨터 프로그램은 기본적으로 1차원이다. 이에 비해 사람 유전체는 4차원으로 작동된다. 이것은 하나님의 창조적 능력이 얼마나 위대하신지를 보여주는 가장 강력한 증거 중 하나인 것이다.


1차원 : DNA 분자

사람 유전체는 약 1.8m 길이이다. 그것 전부가 미세한 세포핵 내에 들어가 있다. DNA를 사람의 머리카락 굵기로 가정한다면, DNA의 길이는 50km 이상이 될 것이며, 대략 골프공 크기 안에 들어가 있는 것이 될 것이다. 이것 하나만으로도 하나님은 경이로운 엔지니어시라는 것을 알 수 있다.

DNA에 암호로 들어있는 문자들의 순서를 나열해 놓는다면, 그것은 다음과 같이 보일 것이다 :

CTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTCTGAAAGTGGACCTATCAGCAGGATGT

GGGTGGGAGCAGATTAGAGAATAAAAGCAGACTGCCTGAGCCAGCAGTGGCAACCCAATGGGGT

CCCTTTCCATACTGTGGAAGCTTCGTTCTTTCACTCTTTGCAATAAATCTTGCTATTGCTCACTCTTT

GGGTCCACACTGCCTTTATGAGCTGTGACACTCACCGCAAAGGTCTGCAGCTTCACTCCTGAGCC

AGTGAGACCACAACCCCACCAGAAAGAAGAAACTCAGAACACATCTGAACATCAGAAGAAACAA

ACTCCGGACGCGCCACCTTTAAGAACTGTAACACTCACCGCGAGGTTCCGCGTCTTCATTCTTGA

AGTCAGTGAGACCAAGAACCCACCAATTCCAGACACACTAGGACCCTGAGACAACCCCTAGAAG

AGCACCTGGTTGATAACCCAGTTCCCATCTGGGATTTAGGGGACCTGGACAGCCCGGAAAATGAG

CTCCTCATCTCTAACCCAGTTCCCCTGTGGGGATTTAGGGGACCAGGGACAGCCCGTTGCATGA

GCCCCTGGACTCTAACCCAGTTCCCTTCTGGAATTTAGGGGCCCTGGGACAGCCCTGTACATGA

GCTCCTGGTCTGTAACACAGTTCCCCTGTGGGGATTTAGGGACTTGGGCCTT

이것은 사람 Y 염색체(human Y chromosome)의 처음 700개의 글자이다. 동일한 염기서열을 가지고 4글자를 4색의 화소(pixels)로 대체한다면, 그림 2에서 보이는 것과 같은 것을 얻게 된다.[2] 이것은 매우 인상적이지 않은가?

그림 2 : 스키틀 유전체 시각화 도구(Skittle Genome Visualization Tool)를 사용하여 보여진 사람 Y 염색체의 시작 부분. 이 그림에서 많은 반복적인 DNA 요소(줄무늬)들을 볼 수 있다. 이러한 반복은 '유전자'를 포함하지 않을 수도 있지만, 3차원 공간의 특정 위치에서 유전자들을 유지하는 역할을 한다. 커다란 검은 영역은 인간 게놈 프로젝트(human genome project)가 생략하고(skip) 넘어갔던 반복 부분이다.(그들은 아직 매우 반복적인 DNA를 시퀀스 하는 기술이 없다). 유전체의 1차원을 나타내는 4개의 글자들을 순서대로 나열해놓은 많은 정보들이 있지만, 이것은 유전체의 전체 정보에 비하면 빙산의 일각으로 매우 적은 일부분에 불과하다.


유전체의 1차원은 단순히 글자들의 순서이다. 그 글자들은 유전자들에 적혀있는 것이고, 그 유전자들은 세포가 해야 할 일을 말해주고 있다. 이것도 복잡하지만, 상황은 더욱 복잡해진다.


2차원 : 상호작용하는 네트워크

유전체의 2차원은 DNA의 한 부분이 또 다른 부분과 상호작용하는 방법과 관련되어 있다. 우리가 이미 보았듯이, 1차원은 쉽게 그릴 수 있다. 그러나 2차원을 그리려면, 먼저 DNA의 선형 문자열의 다른 부분들을 연결하는 많은 화살표들을 그릴 필요가 있다. 그러나 유전체의 전체 상호작용 네트워크를 그린다는 것은 불가능하다. 그래서 한 작은 예만을 살펴보고자 한다.


마이크로 RNA(microRNA, miRNA)는 유전자 기능의 조절에 관여하는 매우 작은(약 22개 뉴클레오티드) 분자이다. 그림 3은 동맥경화증(atherosclerosis)에 대응하여 상향 조절되고 있는, 13개의 유전자들에서 작동되고 있는 miRNA 조절 네트워크의 한 부분을 보여주고 있다. 이들 유전자들은 262개 miRNAs에 의해 표적이 되고, 372개의 '조절 관계(regulatory relationships)'를 맺고 있다. 그림 3에 포함되지 않은 33개의 다른 유전자들이 있고, 그들은 295개의 miRNAs에 의해서 신체가 이러한 상황에 처할 때 하향 조절되고 있다. 기억해야만 하는 것은, 이것은 유전체의 2차원에 대한 극히 작은 부분에 불과하다는 것이다!

그림 3 : 유전체의 2차원에 대한 좋은 예가 되고 있는 miRNA 조절 네트워크의 일부분. 그림에서 오렌지색 영역은 동맥경화증과 관련하여 262개의 miRNAs(라벨을 가진 녹색 점)에 의해서 상향 조절되고 있는 13개의 유전자들을 나타낸다. 그리고 이들 miRNAs들은 유전체의 다른 부분에서 만들어진다. (after Lin et al. 2014).[3]


유전체의 2차원은 특이성 인자(specificity factors), 증강인자(enhancers,) 억제인자(repressors), 활성인자(activators), 전사인자(transcription factors) 같은 것들과 관련되어 있다. 이들은 DNA에 암호화되어 있는 단백질들이다. 그러나 그들은 만들어진 후에 유전체의 다른 부분으로 이동하고, 어떤 것의 스위치를 켜거나 끈다. 그러나 이 차원에서 일어나는 추가적인 것들이 있다. 단백질의 제조 공정 중에, 한 유전자는 ‘전사(transcription)’라 불리는 과정 동안에 세포에 의해서 '읽혀진다'. 여기에서, DNA는 RNA라 불리는 분자에 복사된다. 그리고 RNA는 한 단백질로 번역된다. 우리는 이 과정에 대한 훌륭한 애니메이션을 가지고 있다.(multimedia site). 그러나 전사후 조절(post-transcriptional regulation)이라 불리는 과정에서, RNA가 유전체의 또 다른 부위에 코딩되어 있는 다른 인자(miRNA 같은)에 의해서 활성화되기도 하고, 불활성화 되기도 한다.


수백만 달러의 연구자금이 들어갔던 엔코드 프로젝트(ENCODE project)는 아직 완전히 이해하지는 못하고 있었던, 유전체에 관한 어떤 것들을 밝혀냈다. 가장 큰 미스터리 중 하나는 약 22,000개의 유전자들이 300,000개 이상의 서로 다른 단백질들을 어떻게 생산하는지 그 방법에 관한 것이다. 그 답은 세포가 ‘선택적 스플라이싱(alternate splicing)’이라 불리는 한 과정을 통해서 진행한다는 것이다. 그 과정에서 유전자는 잘려지고, 조각나서, 다른 부분들이, 다른 시간에, 다른 세포들에 의해서 사용되어서, 다른 환경 하에서, 많은 다른 단백질들이 만들어지는 것이다. 이 믿을 수 없도록 극도로 복잡한 과정도 유전체의 2차원에서 단지 작은 한 부분에 불과한 것이다.


3차원 : DNA의 입체 구조

각 염색체는 핵 내에서 지정된 특별한 위치에 있을 뿐만 아니라, 함께 사용되는 유전자들은 일반적으로 서로 3차원 공간에서 인접하여 발견된다. 심지어 유전자들이 서로 다른 염색체에서 발견될 때에도 그렇다!

인간 게놈 프로젝트(Human Genome Project)로 밝혀진 가장 큰 사실중 하나는, 함께 사용되는 유전자들이 유전체 내에서 반드시 서로 가까이에 위치하지는 않는다는 것이었다. 진화론자들은 ”그것은 그냥 쓰레기(junk)이다”, 또는 ”유전체는 수백만 년의 시간 동안에 일어난 유전적 사고(genetic accidents)의 축적에 불과하다”와 같은 주장들을 했었다. 그러나 이러한 주장은 오래 가지 못했다. 왜냐하면, 과학자들이 유전체가 핵 안에서 어떻게 조직화되어 있는지를 살펴보기 시작했을 때[5], 각 염색체는 핵 안에서 지정된 특별한 위치를 가지고 있을 뿐만 아니라, 함께 사용되는 유전자들은, 심지어 다른 염색체에서 발견되는 유전자들이라도 일반적으로 3차원적 공간에서 서로 서로 인접하여 발견된다는 것을 알게 되었다. 


유전체의 3차원은 DNA 분자의 모양이 다른 유전자들의 발현과 조절에 어떻게 영향을 미치는지와 관련되어 있다. 우리는 감겨진 DNA 사슬 깊이 묻혀있는 DNA 부분이 쉽게 활성화될 수 없다는 것을 알고 있다.[4] 그래서 자주 사용되는 유전자들은 일반적으로 쉽게 접근할 수 있는 위치에 있다. 따라서 하나님이 1차원적 DNA 가닥에 유전정보를 써넣으실 때에, DNA가 3차원 모양으로 접혀졌을 때에 서로 정확한 위치들에 위치하도록, 의도적으로 어떤 순서를 가지고 그것들을 써넣으셨어야만 했다. 

그림 4. 핵 내에서 사람 염색체의 3D 위치. 깊게 매립된 유전자들은 접근하기가 쉽지 않기 때문에, 염색체의 입체적(3차원) 접혀짐은 유전체의 전체 기능에 있어서 엄청나게 중요하다. (from Bolzer).[5]


4차원 : 처음의 3차원이 변경됨

유전체의 4차원은 시간(time)이 흐르면서 처음의 3차원이 변경되는 것과 관련되어 있다. 그렇다. 도저히 믿을 수 없어 보이지만, 그것이 사실이다. 모양(3차원), 상호 네트워크(2차원), 글자 순서(1차원), 모든 것들이 변경된다. 이것은 지금까지 유례가 없는 것으로, 인간이 만든 가장 최첨단 컴퓨터도 따라올 수 없는 것이다.


4차원은 여러 가지 방법으로 설명될 수 있다. 다른 간세포(liver cells)들은 다른 염색체 수를 가지고 있다는 것이 알려져 있다.[6] 이것은 간은 대사 및 해독에 관여하는 어떤 유전자의 복사본을 많이 필요로 한다는 사실에 기인한다. 간은 이들 유전자들의 많은 복사본들로 유전체를 채우는 대신에, 자신의 사용을 위한 복사본들을 만든다. 또한 다른 뇌 세포(brain cells)들은 다양한 트랜스포존(transposons)을 다른 수로, 그리고 다른 위치에 갖고 있다.[7] 진화론자들은 이들 점핑유전자(jumping genes)들을 고대 바이러스 감염으로부터 남겨진 유물로 생각했었다. 문제는 그것들이 사람 뇌의 발달에 있어서 필수적이라는 것이다. 무슨 의미인지 알겠는가? 유전체는 다이내믹하게 자신을 재프로그램 시킨다. 이것은 컴퓨터 과학자들이 오랫동안 해결하려고 애써왔던 것이다. 당신은 통제를 벗어나지 않으면서 자가-변경되는 암호를 만들 수 있겠는가? 또한 트랜스포존은 마우스의 배아 발달을 조절하는 데에 중요하다는 것이 밝혀졌다.[8] 그러한 놀라운 부분을 진화론자들은 오랫동안 '정크 DNA(쓰레기 DNA)'라 불러왔던 것이다!


결론

유전체는 극도로 복잡한 생물학적 컴퓨터(biological computer)에 내장되어 있는, 오류를 자체 수정하며, 스스로 암호를 변경하는, 다중 차원의 운영시스템이다. 거기에는 여러 중첩된(이중) DNA 암호, RNA 암호, 구조 암호들이 들어 있다. 거기에는 DNA 유전자들 및 RNA 유전자들이 들어 있다. 유전체는 그것의 구축 동안에 생물공학적 원리들을 사용하셨던, 고도의 지적 존재에 의해서, 많은 량의 여분(redundancy)들이 있도록 의도적으로 설계되었다. 그러한 여분에도 불구하고, 22,000개 정도의 단백질 암호 유전자들이 상호 협력하여, 수십만 개의 독특한 단백질들을 한 치의 오차도 없이 만들어내도록, 경이로운 수준으로 치밀하게 압축되어 있는 것이다.


나는 진화론자들에게 도전을 하나 하겠다. 유전체의 기원을 설명해보라. 찰스 다윈(Charles Darwin)은 ‘종의 기원’에서 썼다 :

”만약 다수의, 연속적인, 약간의 변경들에 의해서 형성될 수 없을 것 같은, 어떤 복잡한 기관의 존재가 입증된다면, 나의 이론은 완전히 무너질 것이다.”

나는 이 인용문이 (창조/진화 논쟁에서) 남용되고 있다는 것을 알고 있다. 그러나 잠시라도 이것에 대해서 생각해보라. 간단한 생명체는 다윈의 관점으로 설명하기에 쉬웠다. 그러나 더 복잡한 생명체에 대해서는 그 문제는 더욱 어려운 문제가 되고 있다. 유전체는 앞에서 살펴본 것처럼, 극도로 초고도로 복잡하다. 이것은 진화론자들을 매우 불편하게 만들고 있는 것이다.


유전체는 알려진 자연적 과정을 통해서는 절대로 생겨날 수 없다고 나는 생각한다. 이 도전에 응전하기를 원하는 진화론자는 정보 변경의 원인, 필요한 돌연변이의 양, 필요한 선택적 힘... 등이 모두 적절한 시간에 작동되도록 하는 것 등을 포함하여, 적절한 시나리오를 우리에게 보내 달라. 진화론자들은 수십억 년이 걸린다하더라도, 무작위적인 자연적 과정은 그들이 필요로 하는 것을 만들 수 없다는 것을 발견하게 될 것이다. (참고 : DVD ‘The High Tech Cell).



Related Articles
Splicing and dicing the human genome


References and notes
1. Yan, K.-K., et al., Comparing genomes to computer operating systems in terms of the topology and evolution of their regulatory control networks. PNAS 107(20):9186-9191, 2010.
2. Seaman, J., and Sanford, J., Skittle: a 2-dimensional genome visualization tool. BMC Bioinformatics 10:452, 2009.
3. Lin, M., Zhao, W., and Weng, J., Dissecting the mechanism of carotid atherosclerosis from the perspective of regulation, International Journal of Molecular Medicine 34:1458-1466, 2014.
4. van Berkum, N.L., Hi-C: a method to study the three-dimensional architecture of genomes, Journal of Visualized Experiments 6(39):1869, 2010.
5. Bolzer, A., et al., Three-dimensional maps of all chromosomes in human male fibroblast nuclei and prometaphase rosettes, PLoS Biol 3(5):e157, 2005.
6. Duncan, A.W., et al., The ploidy conveyor of mature hepatocytes as a source of genetic variation, Nature 467:707-710, 2010.
7. Baillie, J.K., et al., Somatic retrotransposition alters the genetic landscape of the human brain, Nature 479:534-537, 2011.
8. Tomkins, J., 2012. Transposable Elements Key in Embryo Development; icr.org/article/6928, July 25, 2012.


*관련기사 : 생명체의 정보 기원, '창조주'에서 찾아야만 한다 (2016. 10. 12. 기독일보)
http://www.christiandaily.co.kr/news/72305.html


*관련 동영상 : RNA Splicing


https://www.youtube.com/watch?v=aVgwr0QpYNE

Scientists discover second, secret DNA code


https://www.youtube.com/watch?v=-o_Cj9yDrM4

DNA - God's amazing programming; evidence for his existence


https://www.youtube.com/watch?v=CBeCxKzYiIA

The Mysterious Epigenome. What lies beyond DNA.

https://www.youtube.com/watch?v=RpXs8uShFMo

생명정보의 증거 (youtube 동영상, 한글 자막)


https://www.youtube.com/watch?v=xgiullkAeeY

DNA는 왜 창조를 증거하는가? (youtube 동영상, 한글자막)


https://www.youtube.com/watch?v=F-yRL-I6Edk



번역 - 미디어위원회

링크 - http://creation.com/four-dimensional-genome

출처 - CMI, 2016. 10. 6. (GMT+10)

구분 - 5

옛 주소 - http://www.kacr.or.kr/library/itemview.asp?no=6468

참고 : 6207|6126|6361|6321|6389|6148|5831|6003|5836|5580|5474|6134|5883|5734|5784|5950|5558|5454|5954|5949|6286|5725|5536|5441|5105|5094|5514|3730|512|921|3935|5458|4824|5952|6243|5863|5226|4831|4315|4736|2065|6319|4998|4503|5443|6119|5969|4982|2697|5704|5251|5456|4182|4710|4366|6009|6000

David F. Coppedge
2019-05-02

암호는 저절로 우연히 생겨날 수 없다

 : 생명체에 들어있는 유전정보는 진화론을 부정한다.

(Codes Cannot Create Themselves)

David F. Coppedge

      암호(code)를 작성하려면 먼저 마음(mind)으로부터 시작해야 한다. 그런 다음 암호를 알고 있는 발신자와 수신자를 설계해야 한다.


과학자들도 생물학적 암호가 실제적이고, 어디에나 보편적으로 존재하고 있다는 것을 인정하고 있다. 시생대의 가장 단순한 미생물에서부터, 가장 복잡한 포유동물에 이르기까지, 생물들은 발신자와 수신자간에 전달되는 암호로 된 유전정보들로 가득하다. 와일더 스미스(A.E. Wilder-Smith) 박사는 암호는 그 자체만으로는 의미가 없다는 점을 강조했었다. 발신자와 수신자가 모두 암호에 대한 언어 규칙을 이해할 때만 의미가 있는 것이다.


Biosystems 지의 특별 주제로 다룬 암호생물학(Code Biology) 논문들에서, 유물론적 진화론자들은 생명체의 시작 이전에 암호의 기원을 어떻게든 설명해보려고 시도하고 있었다. 기억해야할 것은, "자연선택(natural selection)"은 유전자 시스템에서 정확한 복제가 이루어지기 전까지는 작동될 수 없다는 것이다. 왜냐하면 자연선택은 자손에게 어떤 유익한 특성을 암호로 전달할 수 없다면, 작동되지 않을 것이기 때문이다. 자연선택을 말하면서, 생명체에 들어있는 암호가 저절로 우연히 만들어졌을 것이라는 믿음은 기적을 믿는 것과 같은 것이다.


RNA 세계(RNA world)에서 초기에 나타나야하는 극복하기 어려운 유전암호 문제.(Wills & Carter, Biosystems). 이것은 아마도 ‘생물학적 정보의 기원’에 있어서 가장 대중적인 이론인 진화론에 대한 최고의 명연설(show-stopper)일 것이다. 윌스와 크레이터(Wills & Carter)는 오류의 재앙이 RNA World와 같은 상향식(bottom-up) 이론을 망칠 것이라는 것을 잘 알고 있었다. 그들은 다윈의 자연선택을 초월하는 원리가 요구된다는 것을 깨닫고 있었다. 그러므로 하나님이 그것에 대한 논리적 결론일 것이다. 그러나 대신에 그들은 어떻게든 "자기조직화(self-organization)"가 신속하게, 견고한, 일치된 암호 시스템을 만들어낼 수 있었다는 믿음의 도약을 하고 있었다. 이것은 기적을 믿는 것과 다름이 없다.

암호화된 단백질 합성의 출현을 설명하기 위해서, 자기촉매 이론(theory of autocatalysis) 내에서 오류가 발생하기 쉬운 정보 전달(복제, 전사, 또는 번역)을 위한 미분방정식이 개발되었다. 여러 방정식들은 궁극적으로는 효소들에 의한 특정 tRNA 아미노산화 출현에 대한 시나리오들의 타당성을 비교해볼 수 있는, 그리고 센트럴 도그마(Central Dogma, 유전정보의 흐름을 나타내는 분자생물학의 기본 원리) 내에 들어있는 분자생물학적 정보를 처리하는 보편적 시스템의 기원과 이 과정의 관계를 비교해볼 수 있는, 하나의 기초를 제공하고 있다. 가설적인 RNA 세계는 이 시스템이 어떻게 생겨났는지 설명할 수 있는 적절한 근거를 제공하지는 못하지만, 다윈의 자연선택을 초월하는 자기조직화 원리는 펩타이드-RNA 세계의 유전자 암호의 신속하고 일치된 전환을 위한 예상치 못했던 견고한 기초를 제공하고 있다.

원인, 생성자, 그리고 암호.(Hofmeyr, Biosystems). "형상인(formal cause)"은 청사진이나 무언가를 위한 계획이다. "작용인(efficient cause)"은 그것을 초래하는 것이다. "보편적 생성자(universal constructor)"는 끝없이 스스로 재생성 되는, 그러한 기계에 대한 요구사항에 주의를 환기시키는, 폰 노이만(Bon Neumann)의 이론적 실체이다.

관계 생물학(relational biology)은 아리스토텔레스의 4 원인론(Aristotle’s four causes)에 대한 로버트 로젠(Robert Rosen)의 공식화를 가능하게 만들었던, 인과관계의 함의에 대한 풍부한 이해에 크게 의존하고 있다. 현재까지 작용인과 목적인(final cause)의 회복이 주요 초점이었다. 형상인은 별로 중요하게 여겨지지 않았다. 그러나 이 논문이 보여주듯이, 생물학적 과정은 아니지만, 여러 유형의 과정들을 이해하는데 있어서 그것은 중요하다. 매핑(mapping)의 그래프 이론적 관계 다이어그램은 관계생물학에서 중요한 역할을 해왔으며, 이 논문의 첫 번째 부분은 다이어그램에서 형상인을 명시적으로 표현하는 방법의 발달에 기여하고 있었고, 그것이 매핑을 형성하기 위해서 작용인과 어떻게 함께 작용하는지를 설명하고 있다. 


언어의 진화적 동력학.(Luc Steels, Szathmáry Eörs, Biosystems). 이 논문은 자기 비판을 하고 있다. 진실과 연결되어 있지 않는다면, 언어는 의미가 없다.

진화론적 동력학의 잘 확립된 틀은 인간의 뇌가 언어(language)를 습득하고 적응할 수 있는 방법과, 언어가 집단 내에서 어떻게 변하는 지에 대한 매혹적인 문제에 적용될 수 있다. 문법적 구조를 다루는 틀은 복제되고 있는 단위이다. 언어는 개인의 두뇌 변화에 따라 출현하고 증식하며, 필요한 표현력, 성공적 의사소통, 적은 인지 노력 등에 대한 기여도를 토대로 선택된다. 이 관점을 채택하는 데에는 두 가지 큰 이점이 있다. (i)진화론적 동력학의 관점에서 적응된 뇌의 신경생물학 모델과 연결된다. 따라서 인간의 뇌가 언어를 구사하는 현저하게 복잡한 능력을 어떻게 얻었는지에 대한 새로운 지평을 열게 된다. 그리고 (ii)진화적 동력학적 과정으로서, 문화적 언어 변화를 연구하기위한 새로운 토대를 제시한다. 이 논문은 이러한 새로운 시각을 소개하고, 경험적 데이터와 계산된 실험에 대한 레퍼런스를 제공하며, 공개된 문제들을 지적하고 있다.

유기촉매 바이트에서 정보의 운반 : 반-생성(Semiopoiesis): 생명의 기원에 대한 새로운 이론. (Dos Santos, Biosystems). 이 과학자들은 암호 정보와 분자 정보를 비교하고 있었다. 이것은 카테고리 분류의 실수이다. 분자에서 그들의 순서는 특성을 나타내는 것이지, 정보를 운반하지 않는다. 유전학에서 염기서열은 중요한 부분이다. 그것은 기호학적(기호에 기초한) 유전정보를 전달하고 있다. 도스 산토스(Dos Santos)는 "유기촉매(organocatalysts)"가 분자들을 정보를 전달하는 유전적 생체고분자로 바꾸어줄 수도 있었을 것으로 추정하고 있었다. 그러나 그러한 일은 일어나지 않을 것이다. 자석에 의해 끌어당겨진 철자들의 무작위적 수집으로 의미가 통하는 문장이 만들어질 수 있을까? 산토스는 또한 "자연선택에 의해 진화할 수 있는" 시스템과 생명체를 혼동하고 있었다. 생명체는 우연히 발생할 수 없어 보인다!

살아있는 생명체는 반복적으로 구성요소들을 생성하며, 경계가 유지될 수 있는 화학적 시스템이며, 자동 복제되는 기계로서 고전적으로 묘사되어 왔다. 반면에, 매우 간단한 자기생산적 미셀(autopoietic micelles)이 실험실에서 생산되었다. 그것들은 자신의 계면활성제의 생산을 촉매할 수 있는 미셀(micelles, 작은 분자의 응집에 의해서 형성된 교질입자)로 구성되어있다. 그러나 이러한 자가생성 시스템이 진화할 수 없다는 것은 매우 분명하다. 이런 방식으로 이들 자기생산 미셀들이 항상 진화적 관계로 연결되어 있는, 살아있는 생명체와 관련될 수 없다. 여기서 나는 살아있는 생명체는 분자 정보를 보존할 수 있는, 자기생산적 시스템의 한 종류라고 주장한다. 그 특성은 반-생성(semiopoiesis)이라는 용어로 표현될 수 있다. 그들의 생성물에 대한 분자적 정보를 정의함으로써, 반-생성 시스템은 미디움(medium)과의 상호작용을 제어하고, 조직 유지에 유익한 분자 정보를 자손에게 전달할 수 있기 때문에, 반-생성 시스템은 자연선택에 의해서 진화할 수 있었다. 정보는 일련의 상태 또는 명령들을 갖고 있는 특별한 모양 또는 순서로 말해질 수 있다. 따라서 핵산의 뉴클레오타이드 서열과 같은, 또는 단백질의 아미노산 서열과 같은 분자 정보(molecular information)는 구성 요소들의 배열을 지시하고 있는 특별한 명령이다. 그러나 분자 정보는 뉴클레오타이드 서열에만 국한되지 않는다. 작은 유기화합물의 원자들 또한 다양한 순서를 나타낼 수 있어서, 여러 이성질체(isomers)들이 만들어진다. 서로 다른 이성질체는 매우 다른 화학적 및 물리적 특성을 나타낼 수 있어서, 유기화합물의 생화학적 생물리적 특성은 그것의 조성 및 분자 정보에 의해서, 즉 이들의 원자가 배치되는 특정한 위치에 의해서 결정된다. 이 분자 정보는 선택적 유기촉매(organocatalysts)에 의해서 촉진되는 반응 동안에 보존될 수 있었다. 이러한 방식으로, 생체고분자를 기반으로 한 시스템이 출현하기 이전까지, 유기촉매는 유전정보를 전달하는 원시 매개체의 설득력 있는 후보자가 될 수 있다. 추정되는 유기촉매에 기반한 기초적인 진화가 논의되었다. 마지막으로 필자는 유기촉매 미셀이 관련 산업에 영향을 미치는 프로그램 가능 물질, 인공 광합성, 자가-건설 물질, 인공생명체와 같은 것들을 만들어내기 위해서 설계될 수 있다고 주장한다.

----------------------------------------------------


유물론자들이여, 당신들은 무작위적 과정으로 여기에 있는 것이 아니다. 지성이 없는 분자들은 암호를 만들지 않는다. 그것은 프로그래밍을 필요로 한다. 분자와 생물체 모두 이해할 수 있는 지성과 목표를 가진 누군가가 있어야 한다. 지성이 없는 기호는 무의미하다. 지성을 가진 한 창조자만이 임의의 기호를 선택하여, 의미를 부여할 수 있으며, 그 기호를 해석하고 반응할 수 있는 기계들을 만들 수 있다. 기호 자체, 또는 기호 집합은 아무 것도 할 수 없다. 다른 분자들과 충돌하여 "ATG"라는 뉴클레오타이드가 결합될 수는 있겠지만, 그것이 메티오닌을 만들어낼 수는 없다. 그리고 또 다른 뉴클레오타이드와 결합하여 다른 아미노산 분자들을 만들어내고, 정확한 순서대로 결합시킬 수는 없다. 그것도 모두 L-형 아미노산들로 말이다. 하나의 단백질을 만드는데 필요한 수백 개의 코돈(codon)들이 우연히 만들어질 가능성은 없어 보인다.


박사 학위가 있는 사람이라 하더라도, 지성 없이 생명의 기원을 설명하려는 시도는 우스꽝스러운 것이다. 지성 없이 암호가 만들어질 수 있는 방법은 없다. 모든 유전정보들이 모두 우연히 생겨났다는 주장은 정말로 어리석은 주장이다. 지적설계를 배제하고 생명의 기원을 설명할 수 있는 방법은 없어 보인다. 생물들은 막대한 량의 암호화된 정보로 가득하다. 그 문제를 살펴보고 있는 Biosystems 지의 이번 특별 호를 보게 되어 기쁘다. 그러나 진화과학자들이 살아있는 생명체에서 관측되는 명백한 의미를 무시하고 있다는 것은 실망스러운 일이다.


CEH, 2019. 3. 13.

https://crev.info/2019/03/codes-cannot-create-themselves/

번역 : 미디어위원회


*관련 글 

Brian Thomas
2019-04-17

춤을 추고 있는 세포의 소기관들 

: 세포의 초고도 복잡성이 계속 밝혀지고 있다.
(Dances with Cells)

Brian Thomas

      세포생물학자들은 오랫동안 가장 작은 상호작용(interactions)들에 대해서, 즉 분자들 사이에서 일어나는 상호작용들에 대해 집중해왔다. 최근에 일부 연구자들은 새로운 기술을 사용하여, 세포소기관(organelles)이라고 불리는, 세포의 구획(compartments)에서 무슨 일이 일어나고 있는지를 일부 들여다볼 수 있었다. 그들의 발견은 질병에 대한 새로운 통찰력을 제공하고 있으며, 표준 교과서에 그려져 있는 모든 세포 그림들을 다시 그리도록 만들고 있었고, 세포(cells)를 원형질의 단순한 덩어리(simple blobs of protoplasm)라고 생각하는 사람들에게 커다란 도전이 되고 있었다.

Nature 지는 새로운 연구 결과에 대한 특집 기사를 실었다.[1] 이 기사는 새로운 수업인 것처럼 보인다. 기사에 의하면, 세포소기관(organelles)들은 정교한 방식으로 상호 연결되어 있다는 것이다. 그들은 격리된 구획으로 작동하는 것이 아니라, 둘레가 포장되어 있고, 서로가 서로에 대해 고정되어 있었다. 그리고 그들의 근접은 우연이 아니다.

세포소기관들의 복잡한 배열에 의한 상호연결은 소포체(endoplasmic reticulum)가 미토콘드리아 주위에 역동적으로 접혀져있는 방식을 포함하고 있다. 이렇게 하면(오직 이 방식만), 칼슘, 지질, 당류와 같은 생성물을 잘 교환할 수 있으며, 충분히 빨라서, 세포를 건강하게 유지시킬 수 있는 것이다.

추가 연구에 따르면, 소수의 세포소기관들 사이에 슈퍼-접촉 영역(super-contact zones)이 있음이 밝혀졌다. 이 영역에는 특별한 테더(밧줄, 사슬) 단백질(tether proteins)들이 사용된다.[1] 노스웨스턴 대학의 세포생물학자인 로라 랙크너(Laura Lackner)는 Nature 지에서 다음과 같이 말했다. ”그것은 완전히 다른 차원의 공간적 조직체를 만들어낸다.”[1]

세포는 이미 그들의 DNA 염기서열에서, 이 세상에서 가장 높은 밀도로 압축된 암호화된 언어를 갖고 있으며, 유전적 암호와 후성유전학적 암호들의 배열에 있어서 최고 수준이며, 심지어 염색체 구조의 배열에 있어서도 최고를 자랑한다.[3] 이제 여기에 이러한 복잡성도 추가되게 된 것이다.

일부 세포소기관들은 이들 과학자들의 눈에 마치 춤을 추는 것처럼 운동을 하며, 접촉하고, 분리되고, 다시 만나고 있었다. 병에 걸린 세포는 불균형한 접촉 패턴을 보여주고 있었다. 하버드 대학의 Gökhan Hotamıȿlıgil은 Nature 지에서 ”그것은 매우 우아해 보이지는 않는다”고 말했다. 그러나 콜로라도 대학의 세포생물학자인 기아 볼츠(Gia Voeltz) 교수는, 건강한 세포소기관들이 동료들과 춤을 추고 있는 현미경 영상을 보여주었다. 그녀는 말했다. ”나는 모든 것들이 그렇게 상호 연결되어 있다는 것을 몰랐다. 그것은 너무도 아름답다.”[1]

2017년으로 돌아가서, 미국에 기반을 둔 한 팀의 세포생물학자들은 6개의 개별적으로 색깔을 띤 세포소기관들에 대한 영상을 소개했다.[4] 여기에서 역동적으로 움직이고 있는 이들의 춤을 엿볼 수 있었다.(아래 References 5번 링크 클릭).[5] 이러한 것들은 어디에서 왔을까?

바이츠만 연구소(Wiezmann Institute)의 생물학자인 마야 슐디너(Maya Schuldiner)는 의도하지 않게 그것에 대한 한 대답을 하고 있었다. 그녀는 Nature 지에서 말했다. ”세포소기관들은 고립되어서는 기능을 할 수 없다.”[1]. 이는 필요한 세포소기관들(아마도 모든 세포소기관들)이 그들을 묶고 있는 테더 단백질(tether proteins)들과 동시에 발생했음을 의미한다.

자동차 엔진이 그러한 상황에 대한 적절한 설명이 될 수 있을 것이다. 피스톤, 점화 플러그, 라디에이터와 같은, 필요한 엔진 부품들이 모두 있어야하고, 그들이 올바른 위치에 배치되어 있어야할 뿐만 아니라, 모든 부품들이 단단히 고정되어 있지 않다면, 그것은 고철더미에 불과할 것이다. 그래서 생명체인 세포가 작동되기 위해서는, 세포소기관들이 모두 함께 작동되어야 하는 것이다. 그러나 이들 세포의 엔진 부품들은 서로 붙어있지 않다. 그들은 안무 리듬에 따라 함께 미끄러지며, 접촉과 분리를 진행하는 것이다.

이러한 새로운 ”전부 아니면 무(all-or-nothing)”인 기관의 발견은 그 기원이 창조임을 가리킨다. 이러한 기관은 부품들이 하나씩 하나씩 생겨나는 점진적인 과정을 통해 만들어질 수 없다. 캘리포니아 데이비스 대학의 생물학자인 조디 눈나리(Jodi Nunnari)는 Nature 지에서 말했다. ”이와 같은 종류의 기능적 허브(functional hub)는 세포가 창조된 것처럼 보이게 만든다”고 말했다. 세포가 자동차 엔진 보다 복잡한 이러한 자신의 부품들을 만들어내는 것을 본 사람은 아무도 없다. 세포 안에서 일어나고 있는 이러한 함께 추는 춤은 초자연적 기원을 가리키는 것이다.



References
1. Dolgin, E. 2019. How secret conversations inside cells are transforming biology. Nature. 567(7747): 162-164.
2. Tomkins, J. Epigenetic Code More Complicated Than Previously Thought. Creation Science Update. Posted on ICR.org January 28, 2016, accessed March 29, 2019.
3. Thomas, B. Genomes Have Remarkable 3-D Organization. Creation Science Update. Posted on ICR.org November 15, 2010, accessed March 29, 2019.
4. Valm, A. M. et al. 2017. Applying systems-level spectral imaging and analysis to reveal the organelle interactome. Nature. 546 (7656): 162-167.
5. Valm, A. M. et al. 2017. Supplementary information. Video 1: Point-scanning confocal, 6-colour time-lapse images. Nature. 546 (7656): 162-167.

*Dr. Thomas is Science Writer at the Institute for Creation Research and earned his Ph.D. in paleobiochemistry from the University of Liverpool.


출처 : ICR, 2019. 4. 9.
URL : https://www.icr.org/article/11268/
번역자 : 미디어위원회


Frank Sherwin
2019-04-13

놀랍고, 독특하고, 진정 기괴한 옐로스톤의 미생물 

(Incredible, Unique, and Truly Weird' Yellowstone Microbes)

Frank Sherwin 


       수십 년 동안 옐로스톤 국립공원(Yellowstone National Park)의 뜨거운 온천에는 고균(Archaea)이라 불리는 특별하고 견고한 원핵미생물 유형이 살고 있는 것으로 알려져 왔다. 고세균(archaebacteria)으로 알려진 이들 미생물에는 메탄생성균(methanogens), 극도의 호열균(thermophiles, 열에 잘 견디는 유기체), 극도의 호염균(halophiles, 성장에 소금을 필요로 하는 유기체) 등이 포함된다. 고온성 고세균의 한 종은 유황이 풍부하고, 끓는 물에서도 살아갈 수 있는 술포로부스(Sulfolobus) 균이다. 그들은 극한의 환경에서도 고도로 저항할 수 있도록 설계되었는데, 진화론자들은 그들이 지구의 첫 번째 생명체 형태가 됐을 수도 있다고 제안하고 있다.









창조과학자들은 이 '진정 기괴한' 미생물의 발견을 축하하지만, 그 발견은 진화론과는 아무런 관련이 없다.

최근에 ”믿을 수 없도록 놀랍고, 독특한, 그리고 진정 기괴한” 미생물 집단이 옐로스톤의 높은 고도에서 발견되었다. 창조과학자들은 이 ”진정 기괴한” 미생물의 발견을 축하하지만, 그 발견은 진화론과는 아무런 관련이 없는 것이다. 그러한 극도의 열악한 환경에서도 견디며 살아갈 수 있는 놀라운 미생물 집단의 발견은 창조주의 경이로운 설계를 보여주는 것이다. 이러한 고도의 설계로 인해, 그 미생물들은 서식하기 어려운 열악한 환경도 채울 수 있는 능력을 갖고 있는 것이다. 실제로 고세균은 그들의 세포막에 지방산이 없다는 점에서 전형적인 '박테리아'와 다르다. 대신, 그들은 크렌아케올(crenarchaeol)이라 불리는 독특한 지질을 갖고 있다. 또한 RNA 중합효소(RNA polymerase)라 불리는 단일 유형의 효소를 가진 박테리아와는 달리, 고세균에는 더 복잡한 여러 종류의 효소들을 갖고 있다.

그 기사는 ”어떤 것들은 고대 미생물의 현대적 친척이 될 수도 있으며, 초기 지구의 생명체와 다른 행성에서의 생명체에 대한 잠재적 교훈을 제공할 수도 있다”고 말했다.[1] 여기 지구의 과거와 현재에 내열성 박테리아(호열균)가 존재한다는 것이 화성과 같은 가혹한 환경의 다른 행성에서도 비생명체로부터 생명체가 진화했을 수도 있다는 결론과는 거리가 먼 것이다. 화성의 환경은 너무도 가혹하기 때문에, 화성에서 고온에 견디는 호열성 세균이 진화했을 수도 있다는 주장은 설득력이 있는 것일까?

그 기사는 더 나아가 이렇게 쓰고 있었다 :

그러한 시스템과 그 안에 살아가는 흥미로운 유기체에 대한 추가적인 연구는 미생물 생태계에 대한 중요한 추가적인 통찰력을 제공하고, 생화학적 과정의 진화에 있어서 그들의 역할에 대해 새로운 빛을 비춰줄 것으로 보인다.[1, 2]

창조과학자들은 이 독특한 미생물에 대한 연구가 미생물 생태계 분야를 더 잘 이해할 수 있게 도와줄 것이라는 것에는 동의한다. 그러나 세속적 생물학자들에게 이들 흥미로운 미생물의 생화학적 과정에 대한 진화 연구는 새로운 빛이 아니라, 해로운 광선이 될 것이다.

... 핵심 물질대사와 심지어 중간 물질대사를 포함하는 그들의 경로(과정)의 출현은 특히 수수께끼이다.[3]

옐로스톤(Yellowstone)에 있는 이들 ”믿을 수 없도록 놀랍고, 독특하며, 진정 기괴한” 미생물 집단에 관해 앞으로 많은 사실들이 밝혀질 것이다. 그들은 수천 년 전에 다른 모든 박테리아들과 함께 유사한 형태로 창조된 것이다.



References
1. 'Incredibly' diverse microbial community high in Yellowstone. Sciencedaily. Posted on sciencedaily.com February 27, 2019, accessed March 5, 2019.
2. Colman, D. R., M. R. Lindsay, E. S. Boyd. 2019. Mixing of meteoric and geothermal fluids supports hyperdiverse chemosynthetic hydrothermal communities. Nature Communications. 10:681.
 3. Noda-Garcia, et al. 2018. Metabolite-enzyme coevolution. Annual Review of Biochemistry. 189.

*Mr. Sherwin is Research Associate at ICR. He has a master’s in zoology from the University of Northern Colorado. 



출처 : ICR, 2019. 3. 26.
URL : https://www.icr.org/article/truly-weird-yellowstone-microbes/
번역자 : 미디어위원회



서울특별시 종로구 창경궁로26길 28-3

대표전화 02-419-6465  /  팩스 02-451-0130  /  desk@creation.kr

고유번호 : 219-82-00916             Copyright ⓒ 한국창조과학회

상호명 : (주)창조과학미디어  /  대표자 : 박영민

사업자번호 : 120-87-70892

통신판매업신고 : 제 2018-서울중구-0764 호

주소 : 서울특별시 종로구 창경궁로26길 28-5

대표전화 : 02-419-6484

개인정보책임자 : 김광